Unlock instant, AI-driven research and patent intelligence for your innovation.

Salix matsudana 1, 7-sedoheptulose bisphosphatase as well as encoding gene and application thereof

A technology of sedum heptulose phosphatase and diphosphate, which is applied in the field of genetic engineering, can solve the problems of weakened Calvin cycle renewal ability and reduced photosynthetic activity, and achieves the effect of improved salt tolerance, excellent genetic resources and enzyme resources.

Active Publication Date: 2020-10-02
NANTONG UNIVERSITY
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] 1,7-diphosphate sedoheptulose phosphatase (SBPase) is a key enzyme in the plant Calvin cycle process, and also one of the main rate-limiting enzymes in the plant photosynthesis pathway. Slight inhibition of SBPase activity will lead to Calvin cycle The weakening of circulation renewal ability and the decline of photosynthetic activity
So far there are no reports on Sedoheptulose Heptulose Phosphatase (SBPase) and its role in seed germination and seedling salt resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Salix matsudana 1, 7-sedoheptulose bisphosphatase as well as encoding gene and application thereof
  • Salix matsudana 1, 7-sedoheptulose bisphosphatase as well as encoding gene and application thereof
  • Salix matsudana 1, 7-sedoheptulose bisphosphatase as well as encoding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1: the coding sequence of SmSBPase gene and the acquisition of protein sequence

[0035] Referring to the method of discovering salt-tolerant genes of Salix sativa based on multi-omics determination introduced in Chinese patent CN110484599A, combined with the genome sequence annotation information of Salix sativa and the differentially expressed gene data of salt-tolerant and salt-sensitive Salix sativa plants under salt stress, The SBPase gene of Salix salix was screened out, and its gene coding sequence and protein sequence are shown in SEQ ID NO:1 and SEQ ID NO:2. After Blast comparison with the genome information of red willow (Salixpurpurea) in the phytozome website (https: / / phytozome.jgi.doe.gov / pz / portal.html), it was determined to be Sedoheptulose 1,7-bisphosphate Phosphatase (SBPase) gene, named SmSBPase.

[0036] The above gene coding sequence can be obtained by artificial synthesis and in vitro PCR amplification technology.

Embodiment 2

[0037] Embodiment 2: the acquisition of the recombinant T vector containing SmSBPase gene

[0038] The acquisition of the recombinant T vector comprises the following steps:

[0039] (1) Acquisition of SmSBPase gene: extract RNA from willow leaves, reverse transcribe to synthesize cDNA, use the following primers for PCR amplification, and obtain PCR product 1, which is the SmSBPase cDNA sequence.

[0040] Primer 1: SmSBPase CDS-F

[0041]5'-AACTTGGACATCCAGCTAAAATG-3';

[0042] Primer 2: SmSBPase CDS-R

[0043] 5'-TTAAGCGGCAGCTCCAACAGTAAC-3';

[0044] PCR reaction conditions: pre-denaturation at 95°C for 3 min, 30 sec at 95°C, 38 sec at 56°C, and 50 sec at 72°C, a total of 33 cycles; extension at 72°C for 5 min.

[0045] The PCR product 1 is sequenced, and its nucleotide sequence is shown in SEQ ID NO:3, which consists of 1190 nucleotides and can encode the protein SmSBPase shown in SEQ ID NO:2. Compared with SEQ ID NO:1, SEQ ID NO:3 contains 11 bp 5'-UTR sequence upstream...

Embodiment 3

[0048] Embodiment 3: the acquisition of the recombinant plant expression vector containing SmSBPase gene

[0049] The acquisition of the recombinant plant expression vector comprises the following steps:

[0050] (1) Connection to the plant expression vector Pwm101: Using the pGEM-T-SmSBPase plasmid obtained in Example 2 as a template, PCR amplification was performed using the following primers to obtain PCR product 2.

[0051] Primer 3: Pwm101-SmSBPase-F

[0052] TCGAGCTTTCGCGAGCTCGGTACCATGGAGACTGGTGTAGCATGCTG;

[0053] Primer 4: Pwm101-SmSBPase-R

[0054] GCATGCCTGCAGGTCGACTCTAGATTAAGCGGCAGCTCCAACAGTAAC;

[0055] Both ends of the PCR product 2 were added with 18 nucleotide sequences of the plant expression vector Pwm101, and respectively contained KpnI and XbaI restriction sites. The product sequence is shown in SEQ ID NO:4.

[0056] (2) Acquisition of recombinant plant expression vector: The PCR product 2 obtained in step (1) was recombined with the Pwm101 vector linear...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides salix matsudana 1, 7-sedoheptulose bisphosphatase as well as an encoding gene and an application thereof, and relates to the technical field of gene engineering. The gene is derived from salix matsudana and named as SmSBPase gene, wherein the sequence of the gene is shown as SEQ ID NO: 1, the protein encoded by the gene is 1, 7-sedoheptulose bisphosphatase, and the amino acid sequence of the gene is shown as SEQ ID NO: 2. The gene and the protein coded by the gene provided by the invention have the functions of 1, 7-sedoheptulose bisphosphatase, the salt tolerance of theobtained transgenic arabidopsis thaliana containing the SmSBPase gene is obviously improved, and excellent gene resources and enzyme resources are provided for the research of the salt tolerance of plants.

Description

Technical field: [0001] The invention relates to the technical field of genetic engineering, in particular to a sedoheptulose phosphatase 1,7-bisphosphate and its coding gene and application. Background technique: [0002] Soil salinity is one of the main adverse environmental factors affecting the growth and productivity of plant organs. About 1 billion hectares of land are affected by salt damage and are increasing year by year, accounting for more than 6% of the world's total land area. High concentrations of salt can cause osmotic stress, Na + and Cl - Accumulation of stress and production of reactive oxygen species (ROS), which negatively impact plant metabolism and growth, and lead to reduced crop yields, can cost as much as $27.3 billion per year. In China, it is estimated that about 30% of the saline soil can be reclaimed through different strategies to ensure food security and improve the economic environment. The selection and breeding of salt-tolerant plants w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/55C12N9/16C12N15/82A01H5/00A01H5/10A01H6/20
CPCC12N9/16C12N15/8273C12Y301/03037
Inventor 陈艳红张健江钰娜余春梅刘国元钟非连博琳刘昱朱星兆
Owner NANTONG UNIVERSITY