Targeting vector and nucleic acid composition for constructing liver injury mouse model, and construction method

A targeting vector, mouse model technology, applied in the field of genetic engineering and genetic modification, can solve the problems of being unsuitable for hepatitis virus infection research, affecting the adenovirus infection rate, reducing the expression of uPA, etc., so as to facilitate large-scale breeding and transplantation. The effect of simplified procedures and low mortality

Active Publication Date: 2020-10-02
GEMPHARMATECH CO LTD
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since the maintenance of uPA expression requires repeated adenovirus infection, the host mice are prone to develop resistance, which affects the rate of subsequent adenovirus infection, reduces the expression of uPA, and reduces the efficiency of liver cell reconstruction.
In addition, this model can activate natural immunity after injection of adenovirus, which affects the observation of the immune response to hepatitis virus, and is not suitable for research on hepatitis virus infection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Targeting vector and nucleic acid composition for constructing liver injury mouse model, and construction method
  • Targeting vector and nucleic acid composition for constructing liver injury mouse model, and construction method
  • Targeting vector and nucleic acid composition for constructing liver injury mouse model, and construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] The targeting vector provided in this example for the construction of a mouse model of liver injury includes: a target sequence and a 5' homology arm sequence (Rosa26 arm1) used to mediate the insertion of the target sequence into the target site (Rosa26) in the mouse genome ) and the 3' homology arm sequence (Rosa26 arm2) (for the positional relationship of each element, see figure 1 ).

[0077] Wherein, the target sequence sequentially includes a first expression cassette and a second expression cassette located downstream of the first expression cassette from upstream to downstream;

[0078] The first expression cassette includes the following elements in series: albumin enhancer (Alb enhancer), albumin promoter (Alb Promoter), tetracycline transcriptional activation regulator (Tet-On 3G) and the first polyA (HGH polyA); At figure 1 In the middle direction, expression is driven from left (upstream) to right (downstream).

[0079] The second expression cassette com...

Embodiment 2

[0084] This embodiment provides the method for constructing the targeting vector of Embodiment 1, including the following steps:

[0085] 1.1 Alb enhancer-Alb promoter fragment preparation

[0086] Use the primers in Table 1 to amplify the Alb enhancer-Alb promoter target fragment and recover it for future use. Conditions for PCR amplification are set according to common knowledge in the field.

[0087] Table 1. Alb enhancer-Alb promoter amplification primer list

[0088]

[0089] The nucleotide sequence (SEQ ID NO.1) of one strand of the Alb enhancer-Alb promoter target fragment is as follows (5'-3'):

[0090] ggtggttctcctgtcagtttcgaggggggtacagcttgggctgcaggtcgactctagatcgaattcctgcagc ccgggggatcccggggttgataggaaaggtgatctgtgtgcagaaagactcgctctaatatacttctttaaccaat aactgtagatcattaaccatacttacctcgcatttcattggttcctaccccattacaaaatcataccatctttgcc aaaaagttgtttgactaaatcccttgcgtatgtttgccatctggagctgttcccctctaacccccacccccacccccc atgcacaagactttgtccattcattaaagttatgtaaaacagcaaatttt...

Embodiment 3

[0156] Construct a control targeting vector using the H11 site of the mouse genome as the target insertion site. The schematic diagram of its element structure is shown in Figure 6 , compared with the targeting vector of Example 1, the difference is that the sequences of the homology arms at both ends are different.

[0157] The construction method of the control targeting vector is as follows:

[0158] 1. Preparation of carrier skeleton: PMD18T-H11-CAG-FLPo (provided by Jiangsu Jicui Yaokang Biotechnology Co., Ltd., see Figure 19 ) as a template, using the primers in Table 13 to amplify and obtain a fragment of 4965bp and recover it, digest the product with BglII, and use it as a backbone carrier for future use.

[0159] Table 13. Backbone Vector Amplification Primers

[0160]

[0161] 2 Digest the correctly sequenced targeting vector of Example 1 with BamHI, the fragment sizes after digestion are 5851bp and 5159bp, and recover the 5851bp fragment.

[0162] 3. Use T4 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a targeting vector and nucleic acid composition for constructing a liver injury mouse model, and a construction method, and relates to the technical field of genetic engineering and genetic modification. The targeting vector disclosed by the invention comprises a first expression cassette and a second expression cassette positioned at the downstream of the first expressioncassette; the first expression cassette comprises the following sequential series components: a liver-specific promoter, a tetracycline transcriptional activation regulating factor and a first polyA;and the second expression cassette comprises the following sequential series components: a second polyA, a mouse prourokinase activator coding gene, and a tetracycline-induced promoter. The liver injury mouse model constructed by the targeting vector has henotype of spontaneous liver injury and induction aggravated liver injury; the mouse death rate of the filial generation thereof is low; large-scale breeding can be conveniently carried out; and the invention provides the reliable liver injury mouse model for researching liver diseases.

Description

technical field [0001] The invention relates to the technical field of genetic engineering and genetic modification, in particular to a targeting vector, a nucleic acid composition and a construction method for constructing a liver injury mouse model. Background technique [0002] Liver disease is one of the most serious diseases threatening human health, especially hepatitis B (HBV), hepatitis C (HCV), liver cirrhosis, liver cancer, non-alcoholic fatty liver disease (NAFLD), alcoholic liver disease (ALD) and drug-induced liver injury ( DILI), among which viral hepatitis is the most common. Viral hepatitis is hepatotropic and has strong species and tissue specificity. For example, the natural hosts of hepatitis B virus and hepatitis C virus are limited to humans and a small number of non-human primates (chimpanzees), and only infect the liver tissue of the host. But using chimpanzees for viral hepatitis research is ethically and financially constrained. Due to the complex...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/85C12N15/90C12N5/10A01K67/027
CPCC12N15/85C12N15/907A01K67/0276C12N2830/008C12N2830/002A01K2217/075A01K2227/105A01K2267/03A01K2267/0393A01K67/0275A01K2217/072A01K2217/203A01K2217/206Y02A50/30C12N2830/003
Inventor琚存祥贾冬景赵静
OwnerGEMPHARMATECH CO LTD