Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Phosphorylated antigen polypeptide, phosphorylated antibody and preparation method for phosphorylated antigen antibody

An antigen peptide, phosphorylation technology, applied in biochemical equipment and methods, chemical instruments and methods, peptides containing affinity tags, etc., can solve the problems of unstable synthesis of short peptides, low fusion efficiency of carrier proteins, poor solubility, etc.

Inactive Publication Date: 2020-10-27
安徽朵能生物科技有限公司
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The purpose of the present invention is to provide a phosphorylated antigen polypeptide, an antibody and a preparation method thereof. By mutating the phosphorylated amino acid into aspartic acid, the DNA of the mutated antigen is constructed on the pGEX-6p expression vector, and GST is expressed by Escherichia coli Fusion antigen, the purified antigen mixed with Freund's adjuvant can directly immunize animals, which solves the problems of instability, poor solubility, low fusion efficiency and high cost of synthetic short peptides in the existing traditional methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Phosphorylated antigen polypeptide, phosphorylated antibody and preparation method for phosphorylated antigen antibody
  • Phosphorylated antigen polypeptide, phosphorylated antibody and preparation method for phosphorylated antigen antibody
  • Phosphorylated antigen polypeptide, phosphorylated antibody and preparation method for phosphorylated antigen antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Example 1: Recombinant plasmids pGEX-6p-ERK-pTY, pGEX-6p-YAP1-p127, pcDNA-GFP-ERK-pTY, pcDNA-GFP-YAP1-p127, pcDNA-GFP-ERK-pep and pcDNA-GFP- Construction of YAP1-pep;

[0055] Design primers and introduce enzyme cutting sites EcoRI and XhoI:

[0056] ERK-pep-5:AATTCGACCATGATCACACAGGGTTCCTGACTGAATACGTGGCCACACGTTGGTAGC;

[0057] ERK-pep-3:TCGAGCTACCAACGTGTGGCCACGTATTCAGTCAGGAACCCTGTGTGATCATGGTCG;

[0058] YAP1-pep-5:AATTCACTCCACAGCATGTTCGAGCTCATTCGTCTCCAGCTTCTCTGCAGTTGTGAC;

[0059] YAP1-pep-3:TCGAGTCACAACTGCAGAGAAGCTGGAGACGAATGAGCTCGAACATGCTGTGGAGTG;

[0060] YAP1-p127-5:AATTCACTCCACAGCATGTTCGAGCTCATGACTCTCCAGCTTCTCTGCAGTTGTGAC;

[0061] YAP1-p127-3:TCGAGTCACAACTGCAGAGAAGCTGGAGAGTCATGAGCTCGAACATGCTGTGGAGTG;

[0062] ERK-pTY-5:AATTCGACCATGATCACACAGGGTTCCTGGACGAAGACGTGGCCACACGTTGGTAGC;

[0063] ERK-pTY-3: TCGAGCTACCAACGTGTGGCCACGTCTTCGTCCAGGAACCCTGTGTGATCATGGTCG;

[0064] The primers were annealed to form dimers, and the conditions for annealing the primers to form ...

Embodiment 2

[0066] Example 2: Expression and purification of fusion proteins GST-YAP1-p127 and GST-ERK-pTY

[0067] Ultrasonic disruption of bacteria: add 40ml PBS and 400μl PMSF to the bacteria, ultrasonic cracking; ultrasonic conditions: horn φ6, power 80%, total ultrasonic time 4min, ultrasonic 3s, interval 3s. Rotate and mix the lysed cells at 4°C for 30 minutes, then centrifuge at 10,000 rpm for 20 minutes, take the supernatant and add it to a new centrifuge tube to repeat centrifugation once, and collect the supernatant. Add 300 μl GST Sepharose to the lysed supernatant. Rotate and shake in a chromatographic cabinet at 4°C for 1 to 2 hours. Centrifuge at 4°C and 2000rpm for 2min, and discard the supernatant. Add PBS to the centrifuge tube with gel to 40ml, shake in a chromatographic cabinet at 4°C for 30min, centrifuge at 2000rpm at 4°C for 2min, discard the supernatant, add PBS and repeat twice. Transfer the gel to a 1.5ml EP tube, centrifuge at 2000rpm for 2min, discard the sup...

Embodiment 3

[0068] Example 3: Animal Immunization

[0069] 3.1 Mix the dialyzed antigen with Freund's complete adjuvant or Freund's incomplete adjuvant at a volume ratio of 1:1, and rotate and mix at 4°C for 2 hours until water-in-oil droplets are formed.

[0070] 3.2 Select healthy New Zealand white rabbits about 7 weeks old, and feed them in the animal room for 4 to 6 days to adapt to the environment.

[0071] In the first week, inject 1 mg of antigen GST-YAP1-p127 and Freund's complete adjuvant mixture at 4 points on the left and right thighs of rabbits;

[0072] In the fourth week, inject 1mg of antigen GST-YAP1-p127 mixed with Freund's incomplete adjuvant;

[0073] In the sixth week, inject 1mg of antigen GST-YAP1-p127 mixed with Freund's incomplete adjuvant;

[0074] In the eighth week, inject 1mg of antigen GST-YAP1-p127 mixed with Freund's incomplete adjuvant;

[0075] At the ninth week, blood was collected from the carotid artery. The collected blood was incubated at 37°C for...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a phosphorylated antigen polypeptide, a phosphorylated antibody and a preparation method for the phosphorylated antibody, and relates to the technical field of antibody preparation. The phosphorylated antigen polypeptide comprises the phosphorylated antibody which aims at human ERK (Extracellular regulated protein kinases) protein threonine 202 and tyrosine 204, and the amino acid sequence of the phosphorylated antibody is disclosed by SEQ ID NO.1, wherein Thr (threonine) and Try (tyrosine) are mutated into Asp (aspartic acid); and the amino acid sequence of the phosphorylated antibody which aims at YAP1 (Yes-associated protein 1) protein serine 127 is disclosed in SEQ ID NO:2, wherein Ser (serine) is mutated into Asp. A phosphorylated amino acid is mutated into theaspartic acid, the DNA (deoxyribonucleic acid) of a mutant antigen is constructed to a pGEX-6p expression carrier, escherichia coli is used for expressing a GST (glutathione S-transferase) fusion antigen, and after the purified antigen and Freund's adjuvant are mixed, an animal can be directly immunized. The method is simple, has good antigen stability, and is high in solubility and low in cost.

Description

technical field [0001] The invention belongs to the technical field of antibody preparation, and in particular relates to a method for preparing a phosphorylated antigen antibody specifically directed against threonine 202 and tyrosine 204 of human ERK protein and a phosphorylated antigen antibody against serine 127 of YAP1 protein. Background technique [0002] Antibodies are an important tool for protein function research, and have been widely used in clinical applications such as diagnosis and treatment of tumors and other diseases. Therefore, an antibody preparation method that specifically recognizes protein phosphorylation sites needs to be further developed. [0003] At present, the main method for producing phosphorylated antibodies is: solid-phase synthesis of phosphorylated polypeptide antigens, and then coupling the antigens to hemocyanin (KLH) or bovine serum albumin (BSA) to obtain fusion antigens and immunize animals. In traditional methods, synthetic short pep...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/12C07K14/715C07K14/82C07K19/00C07K16/06C07K16/28C07K16/32C07K16/40C07K16/44C12N15/70
CPCC07K14/715C07K14/82C07K16/06C07K16/2866C07K16/32C07K16/40C07K16/44C07K2319/23C12N9/12C12N15/70C12Y207/10001
Inventor 徐雪姣蔡春林
Owner 安徽朵能生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com