Black-headed gull TLR7 protein cloning and expressing and polyclonal antibody preparing
A black-headed gull, polyclonal antibody technology, applied in the field of bioengineering, can solve the problems of differences in the types and characteristics of TLR receptors, different species, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Example 1: Bioinformatics analysis of TLR7 gene
[0049] (1) Basic physicochemical properties of the protein encoded by the TLR7 gene
[0050] Using the protein analysis tool ProtParam to analyze the TLR7 protein components, the results showed that the TLR7 protein sequence encoded 393 amino acids, its protein molecular weight was about 63KD, and its theoretical isoelectric point was 9.25. The atomic composition is: C: 2080; H: 3256; N: 556; O: 567; S: 19, the total number of atoms is 6478, and the molecular formula is C 2080 h 3256 N 556 o 567 S 19 , the protein with higher amino acid content is Leu (15.0%), Asn (7.4%) and Thr (6.4%), while the amino acid content is less for Met (2.0%), His (2.0%) and Trp (2.5%) %) (as shown in Table 1).
[0051] Table 1 Amino acid composition of TLR7 of red-headed gull
[0052]
[0053]
[0054] (2) Prediction results of post-translational modification of TLR7 protein
[0055] Using the online program NetNGlyc1.0 to anal...
Embodiment 2
[0070] Example 2: Cloning of red-billed gull TLR7 and construction of expression vector
[0071] 2.1 Primer design for TLR7 gene
[0072] According to the amplified TLR7 gene sequence of the black-headed gull obtained in the laboratory, primers were designed using the biological software primer6.0. The two upstream and downstream restriction sites are EcoRI and XhoI respectively. The estimated length of the amplified fragment is 1182bp;
[0073] Upstream primer T1: GAATTCATGGGTTGTGCTCTAATCCT,
[0074] Downstream primer T2: CTCGAGCTAAACAGTTTCTTGGAGTA
[0075] 2.2 PCR amplification of TLR7 gene
[0076] The TLR7 gene PCR product obtained in the laboratory was used as a template, and T1 and T2 were used as primers to amplify the TLR7 gene sequence. The PCR reaction system is shown in Table 2, and the reaction conditions are shown in Table 3. Take 5 μL TLR7 gene amplification product for agarose gel electrophoresis.
[0077] Table 2 The reaction system of TLR7 gene PCR
[00...
Embodiment 3
[0108] Embodiment 3: Construction of TLR7 gene prokaryotic expression vector
[0109] (1) Cultivate the pET-32a(+) strain and the pMD18-T-TLR7 strain, and extract the plasmid according to the instructions;
[0110] (2) The pET-32a(+) and recombinant pMD18-T-TLR7 plasmids were reacted at 37°C for 2 hours according to the enzyme digestion reaction system. The system is shown in Table 6:
[0111] Table 6 Reaction system for double enzyme digestion
[0112]
[0113]
[0114] Recover pET-32a(+) and pMD18-T-TLR7 according to the instructions of Tiangen gum recovery kit, and store them at -20°C.
[0115] The connection conditions of the carrier fragment and the target fragment are as follows:
[0116] Table 7 connected reaction system
[0117]
[0118] The above reaction system was gently pipetted to mix and centrifuged briefly, and then acted at 16°C for 12h.
[0119] Transformation: Transform the above ligation product into Escherichia coli DH5α competent cells,
[01...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Protein molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More