Full-length infectious clone of attenuated vesicular stomatitis virus mutant and application of full-length infectious clone
A technology of infectious cloning and vesicular stomatitis, applied in the direction of virus/bacteriophage, application, virus, etc., can solve the problems of limited popularization and application, high toxicity of normal cells, and killing of cells in brain regions
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] The full-length infectious clone of attenuated vesicular stomatitis virus mutant carrying green fluorescent gene is constructed, and its construction method is as follows:
[0029] PVSV-Venus(addgeneNo.: 36399) used XhoI and MscI to double-cut the vector, and pVSV-EGFP-dG(addgeneNo.: 31842) used XhoI and MscI to double-cut the EGFP. The two were ligated by T4 ligase, and the ligation product was transformed into competent Stbl3. The positive clone identified by PCR was cultured and the plasmid was extracted for sequencing. The clone with correct sequencing was named PVSV-. The full-length infectious clone plasmid pVSV-EGFP of VSV was used as the template to amplify the N1 fragment with Takara PrimerstarPolymerase, and the primers were N1-F (ATCATTGAACACACACACGTTCATT) and N1-R (GTATATTACAATGTCAGGCTGTCGGGCATT). The amplified DNA fragments are detected and recovered in a conventional way; The N2(R7A) fragment was amplified by using the N1 fragment as the template, and the prim...
Embodiment 2
[0035] PVSV-N(R7A)-△M51-EGFP successfully prepared VSV expressing green fluorescence, which comprises the following steps:
[0036] The core plasmid of pVSV-N(R7A)-△M51-EGFP virus genome was co-transfected with packaging plasmids PBS-N, PBS-P and PBS-L (in the mass ratio of 6:6:2:1). BHK-21 cells treated by poxvirus expressing T7 RNA polymerase for 1 hour were treated at 35℃ and 5% (v / v). 2 Culture in an incubator, remove the supernatant after 6 hours, replace it with 2ml of fresh DMEM medium containing 5% fetal bovine serum, and place it in a 5% (v / v) CO2 incubator at 31℃ for further culture. After 24 hours, observe the cell state and fluorescence expression by inverted fluorescence microscope (Olympus), collect the supernatant after 120 hours, filter it with a 0.1μm filter to remove the pox virus and infect the normal BHK-. Using blue excitation fluorescence, obvious green fluorescence signal can be seen ( Figure 1B), indicating that the recombinant virus was successfully rescue...
Embodiment 3
[0038] The application of recombinant VSV prepared by pVSV-N(R7A)-△M51-EGFP at the cellular level includes the following steps:
[0039] BHK-21 cells were inoculated in a 12-well plate for culture. When the cell density was 70% ~ 80%, pVSV-EGFP (hereinafter referred to as WT-VSV, Lin et al. Molecular Brain (2020) 13: 45) and pVSV-N(R7A)-EGFP were inoculated respectively according to the multiplicity of infection (MOI) of 3. Lin et al. Molecular Brain (2020) 13: 45) and pVSV-N(R7A)-△M51-EGFP (hereinafter referred to as VSV-N(R7A)-△M51) viruses were incubated, and then cultured at 35℃ for 72 hours. After observing the cell morphology and fluorescence signal, we found that WT-VSS Figure 2 A); Furthermore, we subcultured the cells infected with VSV-N(R7A)-△M51, and found that the infected cells could grow normally and express green fluorescence ( Figure 2 B)。 The above data indicate that the mutant VSV-N(R7A)-△M51 virus has lower cytotoxicity, and can be used to transduce the target g...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



