Construction method and application of galactosyltransferase GalT gene point mutation mouse model

A galactosyl and mouse model technology, applied to other methods of inserting foreign genetic materials, biochemical equipment and methods, enzymes, etc., can solve the problems of inability to conduct extensive systematic research, many case types, and few samples , to achieve the effect of low production cost, simple production and good repeatability

Inactive Publication Date: 2020-12-01
NANJING AGRICULTURAL UNIVERSITY
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the research on glycosylation diseases mostly focuses on clinical cases, but due to the large number of case types and the small number of samples, it is impossible to conduct extensive systematic research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of galactosyltransferase GalT gene point mutation mouse model
  • Construction method and application of galactosyltransferase GalT gene point mutation mouse model
  • Construction method and application of galactosyltransferase GalT gene point mutation mouse model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 suggests B4GalT1-Y286 gene site-directed mutation mouse model

[0032] 1. Cas9 sample mixing system

[0033] 1. gRNA design

[0034] Such as figure 1 As shown in the construction strategy diagram, it is determined to carry out gene replacement for exon 4 (exon4). The upstream and downstream sequence information of the mutation site is as follows:

[0035] GTCATTACTTGGGGTAAAAACTTACTAGCCATGGGCCCTCTGTCTGTCTTCCTCTCCAGCCTGCCATATGTTCAGTATTTTGGAGGTGTCTCTGCTCTCAGTAAACAACAGTTTCTTGC;

[0036] The sequence information of oligo donor DNA is shown in SEQ ID NO:2:

[0037] GTCATTACTTGGGGTAAAAACTTACTAGCCATGGGCCCTCTGTCTGTCTTCCTCTCCAGCCTGCCATATGTTCAGCTGTTTGGAGGTGTCTCTGCTCTCAGTAAACAACAGTTTCTTGC.

[0038] The gRNA sequence is designed, and the gRNA sequence is shown in SEQ ID NO: 1: 5'-CTGCCATATGTTCAGTATTTTGG-3'.

[0039] 2. Preparation of Cas9 mixed sample system

[0040] Wherein the Cas9 mixed sample system is a mixture, derived from ThermoFisher, which includes gRNA,...

Embodiment 2

[0071] Example 2 Analysis of homozygous serum glycosylation

[0072] Operation method:

[0073] (1) Pretreatment of serum

[0074] 50 μL of serum from homozygous (Ho) mice and wild-type (Wt) mice were taken out from the -20°C refrigerator and thawed at room temperature.

[0075] (2) Enzymatic release of N-chain oligosaccharides

[0076] The prepared serum samples were digested with pre-purified N-glycoamidase (PNGase F), and the reaction system was as follows: add 28 μL deionized water to dissolve the serum, then add 23 μL 500 mM pH 7.5 phosphate buffer, 12.5 μL Denaturing agent (2% SDS aqueous solution, 3% β-mercaptoethanol) was mixed thoroughly and placed on a metal bath, heated at 95°C for 10 minutes to denature the protein, and then the sample was placed on ice, and after it was cooled to room temperature, Add 19 μL of 10% polyethylene glycol octylphenyl ether (Triton-100) solution, mix well, and incubate with 100 μL PNGase F (1.6 mg / mL) at 37° C. overnight.

[0077] (...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a construction method and application of a galactosyltransferase GalT gene point mutation mouse model. The construction method comprises the following steps: (1) target construction: searching a CDS region of a galactosyltransferase B4GalT gene, defining an exon part, and determining a gene mutation site; (2) obtaining of fertilized eggs and microinjection: obtaining cas9 mRNA and gRNA in an in vitro transcription mode, obtaining oligo donor DNA through synthesis, and carrying out microinjection on cas9 mRNA, gRNA and oligo donor DNA into fertilized eggs of a C57BL/6J mouse to obtain an F0-generation mouse; (3) conducting mating propagation on the positive F0-generation mouse and C57BL/6J to obtain a positive F1-generation heterozygote with B4GalT gene site-specificmutagenesis; and (4) after mating of the positive heterozygote mice, performing PCR sequencing confirmation to obtain positive homozygotes, indicating that the mouse model is successfully constructed.The model is simple to manufacture and good in repeatability, can be used for researching medicines for treating abnormal glycosylation diseases of human beings, and has important practical significance for exploring a treatment method.

Description

technical field [0001] The invention belongs to the field of mouse models, and in particular relates to a method for constructing a point mutation mouse model of galactosyltransferase GalT gene and its application. [0002] technical background [0003] Congenital disorders of glycation (CDG), originally known as carbohydrate-deficiency glycoprotein syndrome (CDGS), are a disorder of abnormal N-glycosylation with clinical features involving many organ systems, particularly brain regions Development and function of the gastrointestinal, hepatic, visual, and immune systems, with insufficient sialylation of serum glycoproteins in almost all patients. At present, the research on glycosylation diseases mostly focuses on clinical cases, but due to the large number of case types and the small number of samples, it is impossible to conduct extensive systematic research. Site-directed mutation mice can be bred in batches, which is beneficial for multi-sample research. [0004] Galac...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): A01K67/027C12N15/89
CPCA01K67/0276A01K2227/105A01K2267/0362C12N9/1051C12N15/89
Inventor 约瑟夫·弗戈迈尔刘丽操然
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap