Construction method and application of galactosyltransferase GalT gene point mutation mouse model
A galactosyl and mouse model technology, applied to other methods of inserting foreign genetic materials, biochemical equipment and methods, enzymes, etc., can solve the problems of inability to conduct extensive systematic research, many case types, and few samples , to achieve the effect of low production cost, simple production and good repeatability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1 suggests B4GalT1-Y286 gene site-directed mutation mouse model
[0032] 1. Cas9 sample mixing system
[0033] 1. gRNA design
[0034] Such as figure 1 As shown in the construction strategy diagram, it is determined to carry out gene replacement for exon 4 (exon4). The upstream and downstream sequence information of the mutation site is as follows:
[0035] GTCATTACTTGGGGTAAAAACTTACTAGCCATGGGCCCTCTGTCTGTCTTCCTCTCCAGCCTGCCATATGTTCAGTATTTTGGAGGTGTCTCTGCTCTCAGTAAACAACAGTTTCTTGC;
[0036] The sequence information of oligo donor DNA is shown in SEQ ID NO:2:
[0037] GTCATTACTTGGGGTAAAAACTTACTAGCCATGGGCCCTCTGTCTGTCTTCCTCTCCAGCCTGCCATATGTTCAGCTGTTTGGAGGTGTCTCTGCTCTCAGTAAACAACAGTTTCTTGC.
[0038] The gRNA sequence is designed, and the gRNA sequence is shown in SEQ ID NO: 1: 5'-CTGCCATATGTTCAGTATTTTGG-3'.
[0039] 2. Preparation of Cas9 mixed sample system
[0040] Wherein the Cas9 mixed sample system is a mixture, derived from ThermoFisher, which includes gRNA,...
Embodiment 2
[0071] Example 2 Analysis of homozygous serum glycosylation
[0072] Operation method:
[0073] (1) Pretreatment of serum
[0074] 50 μL of serum from homozygous (Ho) mice and wild-type (Wt) mice were taken out from the -20°C refrigerator and thawed at room temperature.
[0075] (2) Enzymatic release of N-chain oligosaccharides
[0076] The prepared serum samples were digested with pre-purified N-glycoamidase (PNGase F), and the reaction system was as follows: add 28 μL deionized water to dissolve the serum, then add 23 μL 500 mM pH 7.5 phosphate buffer, 12.5 μL Denaturing agent (2% SDS aqueous solution, 3% β-mercaptoethanol) was mixed thoroughly and placed on a metal bath, heated at 95°C for 10 minutes to denature the protein, and then the sample was placed on ice, and after it was cooled to room temperature, Add 19 μL of 10% polyethylene glycol octylphenyl ether (Triton-100) solution, mix well, and incubate with 100 μL PNGase F (1.6 mg / mL) at 37° C. overnight.
[0077] (...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


