PLGA multi-target composite nano reagent for targeting tumor neovascularization and preparation method and application of PLGA multi-target composite nano reagent
A technology of tumor neovascularization and PLGA, which is applied in the field of PLGA multi-target composite nano-reagents and its preparation, can solve problems such as storms, long research and development cycles, and threats to the survival of tumor patients
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0035] The present invention also provides a preparation method of the PLGA multi-target composite nano-reagent, comprising the following steps: (1) dissolving PLGA in dichloromethane to obtain a PLGA solution;
[0036] (2) Dissolving in Tris-EDTA after the effective siRNA oligo is mixed with DNA strands to obtain a nucleic acid solution;
[0037] (3) The PLGA solution is vortexed, and added dropwise to the nucleic acid solution to obtain a mixed solution; the ratio of the PLGA nanomaterial in the PLGA solution to the oligonucleotide chain in the nucleic acid solution is 100mg : 100nM;
[0038] (4) Ultrasonic emulsification is carried out to described mixed solution, after the first emulsion that obtains is mixed with mass concentration is 2.5% polyvinyl alcohol and 5mg / mL anti-biotin palmitate solution, is placed in mass concentration and is 0.3% polyethylene Evaporated in an alcohol environment to obtain PLGA nanoparticles bound to oligonucleotides;
[0039] (5) After the ...
Embodiment 1
[0052] Preparation of PLGA nanoparticles and assembly of oligonucleotide chains:
[0053]Poly(lactic-co-glycolic acid), PLGA was purchased from MedChemExpress Company, and first dissolved in dichloromethane (1 mg / ml) at room temperature overnight.
[0054] CD274-siRNA (SEQ ID NO.1, GCCGACUACAAGCGAAUUACU), CD47-siRNA (SEQ ID NO.2, GACUUCUACAGGGAUAUUAAU), PDGFRB-siRNA (SEQ ID NO.3, GGAAGGUGAUUGAGUCUGUGA), EGFR-siRNA (SEQ ID NO.4, GAUCGCAAAGGGCAUGAACUA ), CD155-siRNA (SEQ ID NO.5, GUCCCGUAACGCCAUCAUCUU), FS-DNA (SEQ ID NO.6, GGTGGTGGTGGTTGTGGTGGTGGTGGTAGAGCTTGACGGGGAAATCAAAA) and other oligonucleotide strands (purchased from Genepharma) were mixed in equal amounts and dissolved in Tris-EDTA (10mM Tris- HCl and 1 mM EDTA) so that 100 nM of oligonucleotide chains are contained per 100 mg of polymer.
[0055] When the PLGA solution is vortexed, gradually add the above nucleic acid solution dropwise. The solution was subjected to ultrasonic emulsification, and a solution of 2.5% po...
Embodiment 2
[0058] 1. Experimental method
[0059] 1. Cell culture
[0060] Human genitourinary system tumor cell lines, including breast cancer cell MCF7, ovarian cancer cell SK-OV-3, prostate cancer cell 22Rv1, and kidney cancer cell A-498, were purchased from the Cell Resource Center of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. The above cells were cultured in McCOY's 5A (SIGMA, M4892) medium containing NaHCO 3 2.2g / L, high-quality fetal bovine serum 10%. Culture in an incubator at 37°C with 5% carbon dioxide concentration.
[0061] Collect 5ml of peripheral blood from normal people and add it to a sterile centrifuge tube containing 0.2ml of anticoagulant solution, mix well and draw the blood, add it to the PBMC separation solution, make the blood superimposed on the layered solution, and keep the interface between the two clear; the diluted blood The volume ratio to the layering liquid is 2:1. At 10°C, centrifuge at 2000rpm in a horizontal centrifug...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com