Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

PLGA multi-target composite nano reagent for targeting tumor neovascularization and preparation method and application of PLGA multi-target composite nano reagent

A technology of tumor neovascularization and PLGA, which is applied in the field of PLGA multi-target composite nano-reagents and its preparation, can solve problems such as storms, long research and development cycles, and threats to the survival of tumor patients

Active Publication Date: 2020-12-22
SHANGHAI GERIATRIC INST OF CHINESE MEDICINE
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the above-mentioned monoclonal antibodies have many defects, such as difficult screening, long development cycle, easy to cause a storm of inflammatory factors in the body, and seriously threaten the survival of tumor patients

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PLGA multi-target composite nano reagent for targeting tumor neovascularization and preparation method and application of PLGA multi-target composite nano reagent
  • PLGA multi-target composite nano reagent for targeting tumor neovascularization and preparation method and application of PLGA multi-target composite nano reagent
  • PLGA multi-target composite nano reagent for targeting tumor neovascularization and preparation method and application of PLGA multi-target composite nano reagent

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0035] The present invention also provides a preparation method of the PLGA multi-target composite nano-reagent, comprising the following steps: (1) dissolving PLGA in dichloromethane to obtain a PLGA solution;

[0036] (2) Dissolving in Tris-EDTA after the effective siRNA oligo is mixed with DNA strands to obtain a nucleic acid solution;

[0037] (3) The PLGA solution is vortexed, and added dropwise to the nucleic acid solution to obtain a mixed solution; the ratio of the PLGA nanomaterial in the PLGA solution to the oligonucleotide chain in the nucleic acid solution is 100mg : 100nM;

[0038] (4) Ultrasonic emulsification is carried out to described mixed solution, after the first emulsion that obtains is mixed with mass concentration is 2.5% polyvinyl alcohol and 5mg / mL anti-biotin palmitate solution, is placed in mass concentration and is 0.3% polyethylene Evaporated in an alcohol environment to obtain PLGA nanoparticles bound to oligonucleotides;

[0039] (5) After the ...

Embodiment 1

[0052] Preparation of PLGA nanoparticles and assembly of oligonucleotide chains:

[0053]Poly(lactic-co-glycolic acid), PLGA was purchased from MedChemExpress Company, and first dissolved in dichloromethane (1 mg / ml) at room temperature overnight.

[0054] CD274-siRNA (SEQ ID NO.1, GCCGACUACAAGCGAAUUACU), CD47-siRNA (SEQ ID NO.2, GACUUCUACAGGGAUAUUAAU), PDGFRB-siRNA (SEQ ID NO.3, GGAAGGUGAUUGAGUCUGUGA), EGFR-siRNA (SEQ ID NO.4, GAUCGCAAAGGGCAUGAACUA ), CD155-siRNA (SEQ ID NO.5, GUCCCGUAACGCCAUCAUCUU), FS-DNA (SEQ ID NO.6, GGTGGTGGTGGTTGTGGTGGTGGTGGTAGAGCTTGACGGGGAAATCAAAA) and other oligonucleotide strands (purchased from Genepharma) were mixed in equal amounts and dissolved in Tris-EDTA (10mM Tris- HCl and 1 mM EDTA) so that 100 nM of oligonucleotide chains are contained per 100 mg of polymer.

[0055] When the PLGA solution is vortexed, gradually add the above nucleic acid solution dropwise. The solution was subjected to ultrasonic emulsification, and a solution of 2.5% po...

Embodiment 2

[0058] 1. Experimental method

[0059] 1. Cell culture

[0060] Human genitourinary system tumor cell lines, including breast cancer cell MCF7, ovarian cancer cell SK-OV-3, prostate cancer cell 22Rv1, and kidney cancer cell A-498, were purchased from the Cell Resource Center of Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. The above cells were cultured in McCOY's 5A (SIGMA, M4892) medium containing NaHCO 3 2.2g / L, high-quality fetal bovine serum 10%. Culture in an incubator at 37°C with 5% carbon dioxide concentration.

[0061] Collect 5ml of peripheral blood from normal people and add it to a sterile centrifuge tube containing 0.2ml of anticoagulant solution, mix well and draw the blood, add it to the PBMC separation solution, make the blood superimposed on the layered solution, and keep the interface between the two clear; the diluted blood The volume ratio to the layering liquid is 2:1. At 10°C, centrifuge at 2000rpm in a horizontal centrifug...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a PLGA multi-target composite nano reagent for targeting tumor neovascularization and a preparation method and application of the PLGA multi-target composite nano reagent, and relates to the technical field of biological medicines. According to the PLGA multi-target composite nano reagent for the targeting tumor neovascularization, a PLGA nano material is combined with a plurality of effective siRNA oligo expressed by PD-L1, CD47, PDGFR, EGFR and CD155 in a targeted silencing mode and is loaded with a plurality of DNA fragments having specific sequence and called Fastener Strand, and therefore the muiti-siRNAs (at) PLGA multi-target composite nano reagent is obtained. According to the PLGA multi-target composite nano reagent for the targeting tumor neovascularization, the multi-siRNAs (at) PLGA transfected genitourinary system tumor cell line is utilized to obviously inhibit the proliferation and migration capabilities of genitourinary system tumor cells, obviously enhance the killing activity of CD56 + NK cells and CD8 + T cells on the tumor cells and the release capability of inflammatory factors, and therefore the muiti-siRNAs (at) PLGA multi-target composite nano reagent can be used as a chemotherapeutic preparation for inhibiting the genitourinary system tumors.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to a PLGA multi-target composite nano-reagent targeting neovascularization of tumors and its preparation method and application. Background technique [0002] Genitourinary system tumors seriously endanger human life and health, and the existing radiotherapy, chemotherapy and surgical treatment are not ideal. In recent years, the incidence of genitourinary system tumors has shown a rapid increase year by year, especially breast cancer, ovarian cancer, prostate cancer and kidney cancer. Usually, most genitourinary system tumors do not have many physical symptoms in the early stage, and are easy to be discovered only in the middle and late stages. Chemotherapy is also often used in treatment, but the side effects of chemotherapy drugs are relatively large. While killing tumor cells, they also cause great damage to normal cells in the body. [0003] In recent years, I...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K47/59A61K47/54A61K31/7105A61K31/711A61P13/00A61P15/00A61P35/00A61P37/04A61P35/04
CPCA61K31/7105A61K31/711A61K47/549A61K47/593A61P13/00A61P15/00A61P35/00A61P35/04A61P37/04
Inventor 刘特黄永毅陈川郁志华沈洪亮
Owner SHANGHAI GERIATRIC INST OF CHINESE MEDICINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com