Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Lactoferrin aptamer affinity column and its preparation method and application

A lactoferrin and aptamer technology, applied in biochemical equipment and methods, instruments, analytical materials, etc., can solve problems such as non-immunogenicity, and achieve the effects of low price, reduced use cost, and easy operation.

Active Publication Date: 2022-06-28
BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As a new type of molecule that is artificially synthesized in vitro and has similar functions to antibodies, its research is still in its infancy compared with mainstream antibody technology, but it has shown some advantages that are different from antibodies, such as batch-to-batch Consistent stability, easy modification, no immunogenicity, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lactoferrin aptamer affinity column and its preparation method and application
  • Lactoferrin aptamer affinity column and its preparation method and application
  • Lactoferrin aptamer affinity column and its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1 Screening and affinity determination of lactoferrin nucleic acid aptamers

[0054] Using SELEX technology to select nucleic acid aptamers with high affinity to the target lactoferrin (LF) in vitro, the sequences of the three candidate LF aptamers are as follows (5′-3′):

[0055] LAC1: TCAAGCAGTGCAATTGCAGTATGTTGTTTGTGGTGTT

[0056] LAC6: TCAATGTCCCGATGCAGTCTAACTGTGTTGAGATGT

[0057] LAC9: TCAATATGCCCCCCCAATGCAGTTGGTCCGGTATGT

[0058] The affinity of three candidate LF aptamers was determined by SPR (for specific methods, please refer to He Xiaoqin. Post-SELEX screening evaluation, characterization and new sensing methods of aptamers. Chinese Academy of Military Medical Sciences, 2017). For the measurement results, see image 3 .

[0059] It can be seen that the three aptamers have different affinities with lactoferrin. The affinity of LAC1 was further accurately determined, and the affinity reached 372pM ( Figure 4 ).

Embodiment 2

[0060] Example 2 Preparation of aptamer affinity column and optimization of conditions

[0061] 1. Washing of the carrier: Take 300 μL of N-hydroxysuccinimide (-NHS)-modified agarose into a 2 mL centrifuge tube, and wash twice with 1 mM hydrochloric acid, 1 mL each time;

[0062] 2. Aptamer renaturation: Dissolve 1OD of 5'-terminal amino-modified lactoferrin aptamer-specific DNA in 500 μL MES buffer, renature at 95°C for 5 minutes, and then place at room temperature for 30 minutes;

[0063] 3. Coupling: add the well-renatured aptamer solution to the washed carrier, and shake the reaction at 25°C for 0.5h;

[0064] 4. Blocking: After the coupling product was centrifuged to remove the supernatant, 1 mL of blocking buffer was added, and the reaction was shaken at 25°C for 1 h to obtain the carrier-aptamer filler;

[0065] 5. Washing: The carrier-aptamer packing was washed twice with washing buffer to remove unconjugated aptamers. The washed coupling gel was resuspended in 1 mL ...

Embodiment 3

[0083] Embodiment 3 Utilize lactoferrin aptamer affinity column to purify lactoferrin in milk sample and its detection

[0084] In this example, a lactoferrin standard is quantitatively added to a commercially available milk sample, then purified with the lactoferrin aptamer affinity column prepared in Example 1, and detected by high performance liquid chromatography after purification to determine the recovery rate. details as follows:

[0085] 1. Weigh 10g of liquid milk (accurate to 0.01g), add phosphate extract to make up to 50mL, mix well, centrifuge at 10,000rpm, 4°C for 15min, and absorb the supernatant for purification. The lactoferrin aptamer affinity column was first activated with 5 mL of binding buffer, then accurately pipetted 10 mL of supernatant through the column, rinsed with 10 mL of elution buffer, eluted with 2 mL of phosphate eluent, and collected the elution solution, dilute to 2 mL with phosphate eluent, vortex to mix, and test after passing through a mi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a lactoferrin aptamer affinity column as well as a preparation method and application thereof. The affinity column uses N-hydroxysuccinimide-modified agarose as a carrier, and covalently couples a nucleic acid aptamer capable of recognizing lactoferrin with high affinity and specificity to the carrier. After coupling, the specific affinity and packed solid phase extraction column. The affinity column is mainly used for the specific identification and enrichment of lactoferrin in the sample, and the natural activity of lactoferrin can still be maintained after purification. The method is fast, simple and accurate, and the affinity column can be used repeatedly. It can also be used for the separation and purification of lactoferrin in the sample pretreatment before the detection of large instruments, and has broad application prospects in the fields of cosmetics, food, animal production, and medical treatment.

Description

technical field [0001] The invention belongs to the technical field of biological detection, in particular to a lactoferrin aptamer affinity column and a preparation method and application thereof. Background technique [0002] Lactoferrin (LF) is a non-heme iron-binding protein with a relative molecular weight of about 80KDa, which mainly exists in mammalian milk, especially in colostrum with high lactoferrin content. Lactoferrin has a variety of biological functions. It can not only regulate the transfer of human iron and promote bone growth, but also have antibacterial, antiviral, antioxidant, and immune regulation functions. At present, it has been considered as a safe food additive and is widely used in dairy products and related infant formula food, formula food for special medical purposes, health food and medicine. But so far there is no national testing standard for lactoferrin. Commonly used lactoferrin detection techniques are: enzyme-linked immunosorbent assay,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/115
CPCG01N30/06G01N30/08C12N15/115G01N33/68G01N2030/062G01N2030/085C12N2310/16G01N2333/79
Inventor 栾云霞陆安祥郭晓军
Owner BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com