Unlock instant, AI-driven research and patent intelligence for your innovation.

Plant over-expression luciferase reporter gene recombinant vector, and construction method and application thereof

A luciferase and reporter gene technology, which is applied in the field of plant overexpression luciferase reporter gene recombinant vector and construction, can solve problems such as design difficulties, achieve the effect of simplifying the insertion steps and wide application range

Inactive Publication Date: 2020-12-25
SICHUAN UNIVERSITY OF SCIENCE AND ENGINEERING +1
View PDF6 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of this application is to overcome the problem in the prior art that when the pCAMBIA 3301 binary expression vector is used to express plant proteins, a promoter needs to be added every time a foreign gene is inserted, resulting in difficult design, and a plant overexpression luciferase reporter gene is provided. recombinant vector

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant over-expression luciferase reporter gene recombinant vector, and construction method and application thereof
  • Plant over-expression luciferase reporter gene recombinant vector, and construction method and application thereof
  • Plant over-expression luciferase reporter gene recombinant vector, and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Preparation of plant overexpression luciferase reporter gene recombinant vector pCAMBIA3301-35S-MCS-LUC

[0039] S1: Design the gene sequence of the insert fragment; and synthesize the insert fragment sequentially containing the promoter, the multiple cloning site, and the firefly luciferase reporter gene LUC in the 5'→3' direction by the whole gene synthesis method, and respectively upstream of the promoter Introduce EcoR I, introduce the restriction site of BstE II downstream of the luciferase reporter gene, and then connect it to the pEASY vector to obtain an intermediate vector;

[0040] S2: Digest the pCAMBIA3301 binary expression vector for 3 hours with BstE II restriction enzyme and EcoR I restriction enzyme under the condition of Buffer O buffer solution, and use agarose gel electrophoresis to obtain gel strips, The 8452bp fragment was recovered by cutting the gel, which was the required pCAMBIA3301 binary expression vector fragment; similarly, the BstE II restr...

Embodiment 2

[0043] Preparation of plant overexpression luciferase reporter gene recombinant vector pCAMBIA3301-35S-MCS-RLUC

[0044] S1: Design the gene sequence of the insert fragment; and synthesize the insert fragment sequentially containing the promoter, the multiple cloning site, and the renilla luciferase gene RLUC in the 5'→3' direction by the whole gene synthesis method, and respectively upstream of the promoter Introduce EcoRI, introduce the restriction site of BstE II downstream of the luciferase reporter gene, and then connect it to the pEASY vector to obtain an intermediate vector;

[0045] S2: Digest the pCAMBIA3301 binary expression vector for 3 hours with BstE II restriction enzyme and EcoR I restriction enzyme under the condition of Buffer O buffer solution, and use agarose gel electrophoresis to obtain gel strips, The 8452bp fragment was recovered by cutting the gel, which was the required pCAMBIA3301 binary expression vector fragment; similarly, the BstE II restriction e...

Embodiment 3

[0048] PCR amplification primers were designed according to the firefly luciferase reporter gene of the insert fragment, and the sequences of the PCR amplification primers were:

[0049] F: GAATTCCATGGAGTCAAAGATTCAAAT

[0050] R: GGTNACCTTACACGGCGATCTTTCC

[0051] Take 100 μL of TOP10 competent cells, add 1 μL of the pCAMBIA3301-35S-MCS-LUC plasmid prepared in Example 1, then mix evenly to ensure that no air bubbles are generated, react on ice for 20-30 minutes, and place in a water bath at 42°C for 90 seconds, then Put it on ice for 2 minutes; then add it to 650-800 μL LB liquid medium, and incubate at 37°C, 220rpm for 1 hour; take the solid LB culture plate containing antibiotics, take the bacterial liquid to smear the plate, and put the remaining bacterial liquid at 4°C save.

[0052] According to 0.2 μL of primers, 5 μL of 2×TaqmasterMix, 1 μL of transformed bacteria solution, and 3.8 μL of ddH 2 O Prepare the PCR system, add it to a clean EP tube, and then dispense 10 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a plant over-expression luciferase reporter gene recombinant vector, and a construction method and application thereof, and relates to the technical field of gene reconstruction. The recombinant vector contains a pCAMBIA3301 binary expression vector and an insert fragment, wherein the insert fragment comprises a promoter, a multiple cloning site and a luciferase reporter gene, a nucleotide sequence of the promoter is as shown in SEQ ID No.1 in a sequence table, and a nucleotide sequence of the multiple cloning site is shown as SEQ ID No.2 in the sequence table. The invention also discloses a construction method and application of the recombinant vector. According to the recombinant vector disclosed by the invention, problems that when an existing pCAMBIA3301 binaryexpression vector is used for over-expression, no appropriate restriction enzyme cutting site exists behind a promoter, and a CaMV35S promoter needs to be introduced into the 5'end of a target gene every time when the target gene is inserted are solved, and thereby the insertion step of the target gene is simplified.

Description

technical field [0001] The invention relates to the technical field of gene recombination, in particular to a plant overexpression luciferase reporter gene recombination vector and its construction method and application. Background technique [0002] The pCAMBIA3301 binary expression vector is one of the most commonly used plant expression vectors for Agrobacterium transformation, and many expression vectors used in transgenic research use it as the backbone. For its plasmid map, see figure 1 . [0003] It can be clearly seen from the pCAMBIA3301 binary expression vector map that there is no promoter upstream of the multiple cloning site, so it is difficult to apply to protein overexpression. This vector is suitable for studying the activation or enhancement effect of specific DNA cis elements on reporter genes, but it is very inconvenient to choose this series of vectors when studying the overexpression of specific target proteins in plants. Every time an exogenous gene...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/53C12N15/66C12N1/21C12R1/19
CPCC12N15/8212C12N15/66C12N9/0069C12Y113/12007C12Y113/12005
Inventor 刘义王云林琪宇金昊嵩胡凤陈建平黄维孟渂偲
Owner SICHUAN UNIVERSITY OF SCIENCE AND ENGINEERING
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com