A nucleic acid composition, kit and detection method for detecting human fgfr2 gene fusion mutation
A nucleic acid composition and gene fusion technology, applied in biochemical equipment and methods, recombinant DNA technology, and microbial assay/inspection, etc., can solve problems such as rapid detection of gene fusion mutations, and achieve the effect of reducing the number of detections
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example
[0071] contain FGFR2 Preparation of positive control plasmid for gene fusion mutation
[0072] (1) 18 containing FGFR2 The gene of the gene fusion mutation site was connected with the pcDNA3.1 (+) plasmid, and 18 containing FGFR2 Plasmids for gene fusion mutations. The 18 contain FGFR2 The gene sequence of the gene fusion mutation site is as follows (in the following sequence, the unlined part indicates one gene, and the underlined part indicates another gene):
[0073] FGFR2(17)_BICC1(3) SEQ ID NO. 24
[0074] TGTATTCATCGAGATTTAGCAGCCAGAAATGTTTTGGTAACAGAAAACAATGTGATGAAAATAGCAGACTTTGGACTCGCCAGAGATATCAACAATATAGACTATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAAGCCCTGTTTGATAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGTGTTAATGTGGGAGATCTTCACTTTAGGGGGCTCGCCCTACCCAGGGATTCCCGTGGAGGAACTTTTTAAGCTGCTGAAGGAAGGACACAGAATGGATAAGCCAGCCAACTGCACCAACGAACTGTACATGATGATGAGGGACTGTTGGCATGCAGTGCCCTCCCAGAGACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCACTCTCACAACCAATGAG ATCATGGAGGAAACAA ATACGCAGAT...
Embodiment 1
[0112] Design synthetic primers and probes for mutation sites
[0113] According to NCBI published persons FGFR2 Gene sequence and fusion partner gene sequence (wild-type sequence), for FGFR2 Gene 18 fusion mutations were used to design specific primers and probes. And through the optimization of specific primer and probe system, high sensitivity and specific detection can be achieved, FGFR2 The 18 fusion mutation sites of the gene are shown in Table 1.
[0114] Table 1 FGFR2 Gene Fusion Detection Site
[0115]
[0116] For the selected 18 fusion mutation sites, multiple pairs of specific primers and probes were designed using Oligo 7.0 primer design software. The sequences of primers and probes are shown in Table 2.
[0117] The 5' end of the probe sequence designed in this application is modified with a fluorescent reporter group, and the 3' end of the probe sequence is modified with a fluorescent quencher group. Preferably, the fluorescent reporter group of the tar...
Embodiment 2
[0125] one for detecting people FGFR2 A kit for gene fusion mutation, including primer probe, Taq enzyme, 10×PCR Buffer, dNTPs, MgCl in Example 1 2 and PCR enhancers.
[0126] The final concentration of each reagent in the above kit in the final reaction amplification system is shown in Table 3:
[0127] Table 3 The final concentration of each component in the reaction amplification system
[0128]
[0129] Specifically, taking the 25 μL reaction system as an example, the specific addition amount of each component in the above kit is shown in Table 4:
[0130] Table 4 The amount of each component added in the real-time fluorescent quantitative PCR reaction system
[0131]
[0132] The PCR reaction conditions using the above reaction system are as follows: pre-denaturation at 95°C for 5 minutes, 1 cycle; denaturation at 95°C for 25 seconds, annealing at 64°C for 20 seconds, extension at 72°C for 20 seconds, 15 cycles; denaturation at 93°C for 25 seconds, 60 ℃ annealin...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



