Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A nucleic acid composition, kit and detection method for detecting human fgfr2 gene fusion mutation

A nucleic acid composition and gene fusion technology, applied in biochemical equipment and methods, recombinant DNA technology, and microbial assay/inspection, etc., can solve problems such as rapid detection of gene fusion mutations, and achieve the effect of reducing the number of detections

Active Publication Date: 2021-02-26
JIANGSU SYNTHGENE BIOTECHNOLOGY CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Real-time fluorescent quantitative PCR method cannot be used for rapid detection in view of the existing technology FGFR2 For the problem of gene fusion mutation, the application provides a method for detecting human FGFR2 Nucleic acid composition, kit and detection method for gene fusion mutation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A nucleic acid composition, kit and detection method for detecting human fgfr2 gene fusion mutation
  • A nucleic acid composition, kit and detection method for detecting human fgfr2 gene fusion mutation
  • A nucleic acid composition, kit and detection method for detecting human fgfr2 gene fusion mutation

Examples

Experimental program
Comparison scheme
Effect test

preparation example

[0071] contain FGFR2 Preparation of positive control plasmid for gene fusion mutation

[0072] (1) 18 containing FGFR2 The gene of the gene fusion mutation site was connected with the pcDNA3.1 (+) plasmid, and 18 containing FGFR2 Plasmids for gene fusion mutations. The 18 contain FGFR2 The gene sequence of the gene fusion mutation site is as follows (in the following sequence, the unlined part indicates one gene, and the underlined part indicates another gene):

[0073] FGFR2(17)_BICC1(3) SEQ ID NO. 24

[0074] TGTATTCATCGAGATTTAGCAGCCAGAAATGTTTTGGTAACAGAAAACAATGTGATGAAAATAGCAGACTTTGGACTCGCCAGAGATATCAACAATATAGACTATTACAAAAAGACCACCAATGGGCGGCTTCCAGTCAAGTGGATGGCTCCAGAAGCCCTGTTTGATAGAGTATACACTCATCAGAGTGATGTCTGGTCCTTCGGGGTGTTAATGTGGGAGATCTTCACTTTAGGGGGCTCGCCCTACCCAGGGATTCCCGTGGAGGAACTTTTTAAGCTGCTGAAGGAAGGACACAGAATGGATAAGCCAGCCAACTGCACCAACGAACTGTACATGATGATGAGGGACTGTTGGCATGCAGTGCCCTCCCAGAGACCAACGTTCAAGCAGTTGGTAGAAGACTTGGATCGAATTCTCACTCTCACAACCAATGAG ATCATGGAGGAAACAA ATACGCAGAT...

Embodiment 1

[0112] Design synthetic primers and probes for mutation sites

[0113] According to NCBI published persons FGFR2 Gene sequence and fusion partner gene sequence (wild-type sequence), for FGFR2 Gene 18 fusion mutations were used to design specific primers and probes. And through the optimization of specific primer and probe system, high sensitivity and specific detection can be achieved, FGFR2 The 18 fusion mutation sites of the gene are shown in Table 1.

[0114] Table 1 FGFR2 Gene Fusion Detection Site

[0115]

[0116] For the selected 18 fusion mutation sites, multiple pairs of specific primers and probes were designed using Oligo 7.0 primer design software. The sequences of primers and probes are shown in Table 2.

[0117] The 5' end of the probe sequence designed in this application is modified with a fluorescent reporter group, and the 3' end of the probe sequence is modified with a fluorescent quencher group. Preferably, the fluorescent reporter group of the tar...

Embodiment 2

[0125] one for detecting people FGFR2 A kit for gene fusion mutation, including primer probe, Taq enzyme, 10×PCR Buffer, dNTPs, MgCl in Example 1 2 and PCR enhancers.

[0126] The final concentration of each reagent in the above kit in the final reaction amplification system is shown in Table 3:

[0127] Table 3 The final concentration of each component in the reaction amplification system

[0128]

[0129] Specifically, taking the 25 μL reaction system as an example, the specific addition amount of each component in the above kit is shown in Table 4:

[0130] Table 4 The amount of each component added in the real-time fluorescent quantitative PCR reaction system

[0131]

[0132] The PCR reaction conditions using the above reaction system are as follows: pre-denaturation at 95°C for 5 minutes, 1 cycle; denaturation at 95°C for 25 seconds, annealing at 64°C for 20 seconds, extension at 72°C for 20 seconds, 15 cycles; denaturation at 93°C for 25 seconds, 60 ℃ annealin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This application discloses a method for detecting human FGFR2 Nucleic acid composition, kit and detection method for gene fusion mutation. The nucleic acid composition includes targeting FGFR2 Primers and probes designed for 18 types of fusion mutations in the gene. In addition to the above nucleic acid composition, the kit also includes DNA polymerase, PCR buffer, dNTPs and cations. The application also provides a detection FGFR2 The method of gene fusion mutation first extracts the RNA of the test sample and reverse transcribes it into cDNA, then uses the cDNA as a template to carry out real-time fluorescent PCR reaction with the above kit, and finally judges whether the test sample is negative or positive according to the Ct value. This application can specifically detect at the same time FGFR2 There are 18 kinds of fusion mutations in the gene, the mutation site covers a wide range, the number of detections is reduced, and it has the advantages of high sensitivity, good repeatability, simple operation, fast detection speed, and easy interpretation of the results.

Description

technical field [0001] The present application relates to the technical field of in vitro molecular diagnosis, in particular to a nucleic acid composition, kit and detection method for detecting fusion mutations of the human FGFR2 gene. Background technique [0002] Cholangiocarcinoma (CCA) is a highly heterogeneous malignant tumor originating from bile duct epithelial cells, accounting for about 3% of all gastrointestinal malignancies, and is the second most common hepatobiliary malignancy after liver cancer. In my country, the incidence and mortality of cholangiocarcinoma are increasing year by year. Cholangiocarcinoma is highly malignant and progresses rapidly. Radical surgery is currently the only effective cure. However, most patients (65%) are diagnosed at an advanced stage and lose the chance of surgical resection. They are prone to recurrence after surgery, and the prognosis is extremely poor. . For patients with unresectable or metastatic CCA, gemcitabine combined...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6886C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q1/6886C12Q2600/156C12Q2600/16C12Q2600/166C12Q2521/101C12Q2531/113C12Q2545/101C12Q2563/107C12Q2537/143
Inventor 丁晓麟张硕肖潇黄磊童坤
Owner JIANGSU SYNTHGENE BIOTECHNOLOGY CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com