Supercharge Your Innovation With Domain-Expert AI Agents!

Application of a circular RNA as a diagnostic marker for pancreatic cancer

A technique for pancreatic cancer and rings, applied in the field of molecular biology, can solve the problems of not being disclosed, and achieve the effect of short cycle, high sensitivity and strong specificity

Active Publication Date: 2022-07-12
宁波大学附属第一医院
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no published research report on the detection kit of hsa_circ_0047834 by real-time fluorescent quantitative PCR in pancreatic cancer at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of a circular RNA as a diagnostic marker for pancreatic cancer
  • Application of a circular RNA as a diagnostic marker for pancreatic cancer
  • Application of a circular RNA as a diagnostic marker for pancreatic cancer

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment

[0020] 1. Collect 20 pancreatic cancer tissues and corresponding paired adjacent tissues from June 2018 to June 2020 in the Eastern District Hospital of Ningbo Lihuili Hospital. At the same time, plasma samples from 30 patients with pancreatic cancer and 30 healthy people were collected.

[0021] Inclusion criteria: 1. The collection of all blood samples requires the informed consent of the patients and their families; 2. Patients with pancreatic ductal adenocarcinoma must be pathologically confirmed after surgery, or have cancer cells on ultrasound-guided needle cytology biopsy; 3. Patients with chronic pancreatitis Diagnosis was based on the 2014 American Pancreatic Association (APA) consensus.

[0022] Exclusion criteria: 1. Patients with pancreatic ductal adenocarcinoma who received preoperative neoadjuvant chemotherapy or radiotherapy; 2. Patients with benign pancreatic tumors or borderline malignant tumors; 3. Patients with pancreatic metastases (renal cancer, lung cance...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of a circular RNA as a diagnostic marker for pancreatic cancer. The circular RNA is RNA hsa_circ_0047834, and its nucleotide sequence is as shown in SEQ ID NO. 1, and the sequence is reverse spliced ​​to form a closed circular RNA molecule , which is characterized by the application of circular RNA hsa_circ_0047834 and its gene-related products in the diagnosis of pancreatic cancer. The kit for detecting the relative expression of hsa_circ_0047834 includes the upstream primer GTTTTCACTGTTCGACCGGC; Relative expression provides a pancreatic cancer detection method with simple operation, high sensitivity, strong specificity, short cycle and stable results.

Description

technical field [0001] The invention belongs to the field of molecular biology, and in particular relates to the application of a circular RNA hsa_circ_0047834 as a diagnostic marker for pancreatic cancer. Background technique [0002] Pancreatic cancer is a malignant tumor of the digestive system, with insidious onset, rapid development, difficulty in early diagnosis and poor prognosis. The morbidity and mortality of pancreatic cancer are increasing year by year in the world, ranking the seventh in the mortality rate of malignant tumors in China. Currently, surgical resection remains the mainstay of treatment for pancreatic cancer, however, the 5-year survival rate for surgical patients is still as low as 6%. The key to improving the prognosis of pancreatic cancer mainly lies in early diagnosis and early treatment, through detection of relevant molecular markers in high-risk patients, and early and timely intervention. CA19-9 has been used clinically for many years, but i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6886C12Q1/6851C12N15/113C12N15/11A61K31/7105A61K48/00A61P35/00
CPCC12Q1/6886C12Q1/6851A61K31/7105A61P35/00C12Q2600/158C12Q2600/178C12Q2531/113C12Q2545/101C12Q2563/107
Inventor 朱予超
Owner 宁波大学附属第一医院
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com