The variable region sequence of a specific anti-clothianidin antibody and the preparation and application of its recombinant complete antibody
A complete antibody and anti-clothianidin technology, applied in the field of genetic engineering, can solve problems such as differences between antibody batches, easy loss of effective genes, and inability of cell lines to produce effective antibodies, achieving high selectivity, high sensitivity, and guaranteed identification active effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0028] Preparation of mouse anti-thiosetoxamine recombinant intact antibodies
[0029] 1) Gene amplification in the variable region of anti-thiosexacin monoclonal antibody
[0030] By mouse immunity, cell fusion and hybridoma cell screening, a hybridoma cell line B2, subtype IgG1 / kappa, which can secrete highly specific anti-thiose amine antibodies, was prepared, and the total RNA of B2 was extracted by Trizol method, and the RNA integrity was better identified by agar gel electrophoresis to meet the requirements of this experiment. Using RNA as a template, 5'Race technology (SMARTer RACE5 / 3'Kit) was used to reverse transcription to synthesize specific cDNA. Among them, the heavy chain and light chain upstream primers are the connector primers included in the kit, the specific primers downstream of the heavy chain are CTCAATTTTCTTGTCCACCTTGGT, and the light chain downstream specific primers are C T C A T G A A G and C T T G
[0031] The procedure for PCR amplification is:
[0032]...
Embodiment 3
[0064] Example 3: Application of recombinant intact antibody on gold standard test strip
[0065] Verified by ELISA and SPR methods, the anti-thiosefen recombinant intact antibody prepared by this method replaces the ascite antibody, so in order to achieve rapid detection of thiazide, the present invention prepares a competitive immunochromatography test strip for the detection of thioxazamine residues.
[0066] First, the preparation of gold standard antibodies
[0067] The optimal buffer labeled in this method is determined in advance to be 0.01 M PBS, the optimal marker pH is 6.5, and the optimal antibody label is 75 μg / mL. Add an appropriate amount of antibody dropwise to 10mL of colloidal gold solution, stir and mix well. After incubation at room temperature for 1 h, the gold standard antibody solution was blocked by 10% BSA and 1% PEG 20000 (final concentrations of 1% and 0.1%, respectively), and then after incubation at room temperature for 1 h, 13500 g, centrifuged at 4 °C f...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


