Supercharge Your Innovation With Domain-Expert AI Agents!

The variable region sequence of a specific anti-clothianidin antibody and the preparation and application of its recombinant complete antibody

A complete antibody and anti-clothianidin technology, applied in the field of genetic engineering, can solve problems such as differences between antibody batches, easy loss of effective genes, and inability of cell lines to produce effective antibodies, achieving high selectivity, high sensitivity, and guaranteed identification active effect

Active Publication Date: 2022-04-19
ZHEJIANG UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among the many recombinant antibody expression systems, the mammalian cell expression system can guide the correct folding of recombinant antibodies and provide accurate various post-translational processing and modification functions, so it can stably produce recombinant antibodies with the same activity as the parental antibody, which not only confirms The accuracy of the variable region sequence of the parental antibody can also solve many problems faced by conventional antibody production, such as the batch-to-batch difference of traditional antibodies, and the effective genes are easily lost during the passage and preservation of cell lines, resulting in the inability of cell lines to produce effective antibodies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • The variable region sequence of a specific anti-clothianidin antibody and the preparation and application of its recombinant complete antibody
  • The variable region sequence of a specific anti-clothianidin antibody and the preparation and application of its recombinant complete antibody
  • The variable region sequence of a specific anti-clothianidin antibody and the preparation and application of its recombinant complete antibody

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0028] Preparation of mouse anti-thiosetoxamine recombinant intact antibodies

[0029] 1) Gene amplification in the variable region of anti-thiosexacin monoclonal antibody

[0030] By mouse immunity, cell fusion and hybridoma cell screening, a hybridoma cell line B2, subtype IgG1 / kappa, which can secrete highly specific anti-thiose amine antibodies, was prepared, and the total RNA of B2 was extracted by Trizol method, and the RNA integrity was better identified by agar gel electrophoresis to meet the requirements of this experiment. Using RNA as a template, 5'Race technology (SMARTer RACE5 / 3'Kit) was used to reverse transcription to synthesize specific cDNA. Among them, the heavy chain and light chain upstream primers are the connector primers included in the kit, the specific primers downstream of the heavy chain are CTCAATTTTCTTGTCCACCTTGGT, and the light chain downstream specific primers are C T C A T G A A G and C T T G

[0031] The procedure for PCR amplification is:

[0032]...

Embodiment 3

[0064] Example 3: Application of recombinant intact antibody on gold standard test strip

[0065] Verified by ELISA and SPR methods, the anti-thiosefen recombinant intact antibody prepared by this method replaces the ascite antibody, so in order to achieve rapid detection of thiazide, the present invention prepares a competitive immunochromatography test strip for the detection of thioxazamine residues.

[0066] First, the preparation of gold standard antibodies

[0067] The optimal buffer labeled in this method is determined in advance to be 0.01 M PBS, the optimal marker pH is 6.5, and the optimal antibody label is 75 μg / mL. Add an appropriate amount of antibody dropwise to 10mL of colloidal gold solution, stir and mix well. After incubation at room temperature for 1 h, the gold standard antibody solution was blocked by 10% BSA and 1% PEG 20000 (final concentrations of 1% and 0.1%, respectively), and then after incubation at room temperature for 1 h, 13500 g, centrifuged at 4 °C f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a variable region sequence of a specific anti-clothianidin antibody. The amino acid sequence of the heavy chain variable region coding gene is shown in SEQ ID NO:2. The invention also discloses an anti-clothianidin recombinant whole antibody, including heavy chain constant region, heavy chain variable region, light chain constant region and light chain variable region, the amino acid sequence of the gene encoding the heavy chain variable region is as follows: Shown in SEQ ID NO:2. The invention also discloses an antibody expression plasmid. The invention further discloses an immune test strip for rapidly detecting clothianidin residue. The sequence genes obtained in the present invention are respectively connected to the expression vectors containing the heavy chain constant region gene and the light chain constant region gene, and the recombinant complete antibody is obtained by using the mammalian cell expression of the double plasmid system, which ensures the recognition of the mouse parent antibody activity, and enables the stable production of anti-clothianidin antibodies in large quantities, and provides reliable core reagents for various immunoassay methods for the detection of clothianidin residues.

Description

Technical field [0001] The present invention belongs to the field of genetic engineering techniques, in particular the preparation and application of a specific anti-thiosermamine antibody variable region sequence and its recombinant intact antibody. Background [0002] Thiazide is a new type of nicotinoid insecticide with thiazole ring, which is widely used to prevent and control the harm of various pests to crops because of its unique structure and excellent performance compared with traditional nicotinoid insecticides. Thiamethoxamine has excellent internal absorption and osmoticity, so it will be distributed in various parts of the crop, and because of its strong water solubility and long half-life, it is easy to enter the surface water and soil through rainfall and irrigation. Studies have shown that there are high levels of thiosexacin residues in surface water, sediments and soils, which pose a significant threat to ecological health and non-target pollinators and aquatic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/44C07K16/46C12N15/13G01N33/558
CPCC07K16/44G01N33/558C07K2317/56C07K2317/64G01N2430/10C07K2317/76G01N33/54387C07K2317/30C07K2317/92Y02A50/30
Inventor 郭逸蓉常云云赵颖刘鹏琰柳颖焦沙沙张天宜朱国念
Owner ZHEJIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More