Variable region sequence of specific anti-clothianidin antibody, and preparation and application of recombinant complete antibody thereof
A complete antibody and variable region technology, applied in the field of genetic engineering, can solve problems such as differences between antibody batches, easy loss of effective genes, and failure of cell lines to produce effective antibodies, etc., to achieve high specificity, high sensitivity, and high sensitivity Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0028] Preparation of Mouse Anti-clothianidin Recombinant Whole Antibody
[0029] 1) Anti-clothianidin monoclonal antibody variable region gene amplification
[0030]After mouse immunization, cell fusion and hybridoma screening, a hybridoma cell line B2, subtype IgG1 / kappa, which can secrete highly specific anti-clothianidin antibody was prepared, and the total RNA of B2 was extracted by Trizol method. The integrity of RNA identified by agarose gel electrophoresis can meet the requirements of this experiment. Using RNA as a template, specific cDNA was synthesized by reverse transcription using 5'Race technology (SMARTer RACE5 / 3'Kit). Among them, the heavy chain and light chain upstream primers are adapter primers included in the kit, the heavy chain downstream specific primers are CTCAATTTTCTTGTCCACCTTGGT, and the light chain downstream specific primers are C T C A T TC C T G T T G A A G C T C T T G A C A A T G G G and C T C A T T C C T G T T G AA G C T C T T G A C G A C G G ...
Embodiment 3
[0064] Example 3: Application of Recombinant Complete Antibody on Gold Label Test Strip
[0065] After ELISA and SPR method verification, the anti-clothianidin recombinant complete antibody prepared by this method replaces the ascites antibody, so in order to realize the rapid detection of clothianidin, the present invention prepares a competitive immunochromatographic test paper for clothianidin residue detection strip.
[0066] 1. Preparation of gold-labeled antibody
[0067]It is pre-determined that the optimum buffer for labeling in this method is 0.01M PBS, the optimum labeling pH is 6.5, and the optimum antibody labeling amount is 75 μg / mL. Add an appropriate amount of antibody dropwise to 10 mL of colloidal gold solution, and stir to mix. After incubation at room temperature for 1 hour, the gold-labeled antibody solution was blocked with 10% BSA and 1% PEG 20000 (final concentrations were 1% and 0.1%, respectively), and then incubated at room temperature for 1 hour, c...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


