Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Variable region sequence of specific anti-clothianidin antibody, and preparation and application of recombinant complete antibody thereof

A complete antibody and variable region technology, applied in the field of genetic engineering, can solve problems such as differences between antibody batches, easy loss of effective genes, and failure of cell lines to produce effective antibodies, etc., to achieve high specificity, high sensitivity, and high sensitivity Effect

Active Publication Date: 2021-01-08
ZHEJIANG UNIV
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among the many recombinant antibody expression systems, the mammalian cell expression system can guide the correct folding of recombinant antibodies and provide accurate various post-translational processing and modification functions, so it can stably produce recombinant antibodies with the same activity as the parental antibody, which not only confirms The accuracy of the variable region sequence of the parental antibody can also solve many problems faced by conventional antibody production, such as the batch-to-batch difference of traditional antibodies, and the effective genes are easily lost during the passage and preservation of cell lines, resulting in the inability of cell lines to produce effective antibodies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Variable region sequence of specific anti-clothianidin antibody, and preparation and application of recombinant complete antibody thereof
  • Variable region sequence of specific anti-clothianidin antibody, and preparation and application of recombinant complete antibody thereof
  • Variable region sequence of specific anti-clothianidin antibody, and preparation and application of recombinant complete antibody thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0028] Preparation of Mouse Anti-clothianidin Recombinant Whole Antibody

[0029] 1) Anti-clothianidin monoclonal antibody variable region gene amplification

[0030]After mouse immunization, cell fusion and hybridoma screening, a hybridoma cell line B2, subtype IgG1 / kappa, which can secrete highly specific anti-clothianidin antibody was prepared, and the total RNA of B2 was extracted by Trizol method. The integrity of RNA identified by agarose gel electrophoresis can meet the requirements of this experiment. Using RNA as a template, specific cDNA was synthesized by reverse transcription using 5'Race technology (SMARTer RACE5 / 3'Kit). Among them, the heavy chain and light chain upstream primers are adapter primers included in the kit, the heavy chain downstream specific primers are CTCAATTTTCTTGTCCACCTTGGT, and the light chain downstream specific primers are C T C A T TC C T G T T G A A G C T C T T G A C A A T G G G and C T C A T T C C T G T T G AA G C T C T T G A C G A C G G ...

Embodiment 3

[0064] Example 3: Application of Recombinant Complete Antibody on Gold Label Test Strip

[0065] After ELISA and SPR method verification, the anti-clothianidin recombinant complete antibody prepared by this method replaces the ascites antibody, so in order to realize the rapid detection of clothianidin, the present invention prepares a competitive immunochromatographic test paper for clothianidin residue detection strip.

[0066] 1. Preparation of gold-labeled antibody

[0067]It is pre-determined that the optimum buffer for labeling in this method is 0.01M PBS, the optimum labeling pH is 6.5, and the optimum antibody labeling amount is 75 μg / mL. Add an appropriate amount of antibody dropwise to 10 mL of colloidal gold solution, and stir to mix. After incubation at room temperature for 1 hour, the gold-labeled antibody solution was blocked with 10% BSA and 1% PEG 20000 (final concentrations were 1% and 0.1%, respectively), and then incubated at room temperature for 1 hour, c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a variable region sequence of a specific anti-clothianidin antibody. The amino acid sequence of a heavy chain variable region coding gene is shown as SEQ ID NO:2. The inventionalso discloses an anti-clothianidin recombinant complete antibody, which comprises a heavy chain constant region, a heavy chain variable region, a light chain constant region and a light chain variable region; and the amino acid sequence of the heavy chain variable region coding gene is shown as SEQ ID NO:2. The invention also discloses an antibody expression plasmid. The invention further discloses an immune test strip for rapidly detecting clothianidin residues. The sequence gene obtained by the invention is respectively connected to an expression vector containing a heavy chain constant region gene and a light chain constant region gene; the recombinant complete antibody is obtained by adopting mammalian cell expression of a double-plasmid system, so that the recognition activity of amouse parent antibody is ensured; the anti-clothianidin antibody can be stably produced in batches; and a reliable core reagent is provided for various immunoassay methods for clothianidin residue detection.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to the preparation and application of a variable region sequence of a specific anti-clothianidin antibody and its recombinant complete antibody. Background technique [0002] Clothianidin is a new type of neonicotinoid insecticide with a thiazole ring. Because of its unique structure and better performance than traditional neonicotinoid insecticides, it is widely used in the control of various pests on crops. harm. Clothianidin has excellent systemic and osmotic effects, so it will be distributed in various parts of crops, and because of its strong water solubility and long half-life, it can easily enter surface water and soil through rainfall and irrigation. Studies have shown that there are high levels of clothianidin residues in surface water, sediment and soil, and these pesticide residues pose a great threat to ecological health and non-target pollinato...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/44C07K16/46C12N15/13G01N33/558
CPCC07K16/44G01N33/558C07K2317/56C07K2317/64G01N2430/10C07K2317/76G01N33/54387C07K2317/30C07K2317/92Y02A50/30
Inventor 郭逸蓉常云云赵颖刘鹏琰柳颖焦沙沙张天宜朱国念
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com