Expression vector for co-expressing secretory IL-7 and selective CCL19 and application of expression vector

An expression vector, IL-7 technology, applied in the field of biomedicine, can solve the problem of reducing the probability of T cells and dendritic cells being recruited into tumors, the inability to recruit peripheral blood immune cells, and the inability of exogenous IL-7 protein Secretion and other problems, to achieve the effect of increased proliferation ability and tumor cell killing efficiency, and low inflammatory side effects

Pending Publication Date: 2021-01-15
GUANGDONG ZHAOTAI INVIVO BIOMEDICINE CO LTD
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, when CAR-T cells remain in the spleen, lymph nodes and other places where there are many immune cells, CCL19 will recruit peripheral blood circulating T cells and dendritic cells to specific parts, reducing the number of T cells and dendritic cells recruited to specific sites. The probability of intra-tumor, the effect of maximally recruiting peripheral blood immune cells into the tumor cannot be achieved
In addition, the secretion of IL-7 protein outside the cell is strictly controlled by T cells, and there is a problem that exogenous IL-7 protein cannot be secreted outside the T cell

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression vector for co-expressing secretory IL-7 and selective CCL19 and application of expression vector
  • Expression vector for co-expressing secretory IL-7 and selective CCL19 and application of expression vector
  • Expression vector for co-expressing secretory IL-7 and selective CCL19 and application of expression vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056]Example 1 Preparation of Lentiviral Vector

[0057]The following nucleic acid molecules are synthesized by the whole gene:

[0058]① CAR molecule formed by the nucleic acid sequence of GM-CSF signal peptide, MSLN scFv, CD8α, 4-1BB and CD3ζ in series (amino acid sequence is shown in SEQ ID NO: 5);

[0059]② by IL-7 signal peptide (SEQ ID NO: 8) and IL-7 (without IL-7 signal peptide) (SEQ ID NO: 2), 2A peptide (SEQ ID NO: 9) and CCL19 (SEQ ID NO :4) nucleic acid molecules formed by tandem nucleic acid sequences;

[0060]③ A secreted IL-7 molecule formed by the nucleic acid sequence of IL-6 signal peptide (SEQ ID NO: 1) and IL-7 (without IL-7 signal peptide) (SEQ ID NO: 2) in series;

[0061]④ A selective CCL19 molecule formed by 2×NFAT-RE-minP promoter (SEQ ID NO: 3) and CCL19 (SEQ ID NO: 4) in series;

[0062]SEQ ID NO: 8:

[0063]atgttccatgtttcttttaggtatatctttggacttcctcccctgatccttgttctgttgccagtagcatcatct;

[0064]SEQ ID NO: 9:

[0065]aaaattgtcgctcctgtcaaacaaactcttaactttgatttactcaaactggctggggatgtagaaagc...

Embodiment 2

[0067]Example 2 Recombinant lentivirus packaging

[0068]In this example, 293T cells are used to prepare recombinant lentivirus. When the 293T cells are spread on a 100mm culture dish to 80-90% of the bottom, lentivirus packaging is performed:

[0069]2h before virus packaging, change the medium to DMEM containing 1% fetal bovine serum, and add 6mL / 100mm petri dish;

[0070]Prepare the plasmid mixture as shown in Table 1. The pWPXLd-expression plasmid includes a lentiviral vector expressing CAR molecule, a lentiviral vector expressing intact IL-7 and CCL19, or a lentiviral expressing secreted IL-7 and selective CCL19 Carrier

[0071]Table 1

[0072]

[0073]

[0074]Add 36 μg PEI to another 500 μL opti-MEM medium, mix well, and let stand at room temperature for 5 minutes;

[0075]Mix the plasmid mixture shown in Table 1 with PEI, mix by pipetting, and let stand at room temperature for 25-30 minutes;

[0076]Add the above mixture dropwise to the 293T cells cultured in a 100mm petri dish;

[0077]After culturing f...

Embodiment 3

[0080]Example 3 T cell activation and lentiviral transfection

[0081]Use Ficoll density gradient centrifugation kit (GE company) to separate peripheral blood mononuclear cells (PBMC) from whole blood, remove red blood cells, and then use MACS Pan-T magnetic beads to sort out T cells;

[0082]The sorted T cells are diluted with medium (AIM-V medium + 5% FBS + penicillin 100 U / mL + streptomycin 0.1 mg / mL) to a cell concentration of 2.5×106Pieces / mL to be used;

[0083]Use CD2 / CD3 / CD28 T cell activation amplification kit (Miltenyi) to activate T cells, that is, the coated magnetic beads are mixed with T cells in a ratio of 1:2, and the final density of T cells is 5×106Piece / mL / cm2, After mixing, place at 37℃, 5% CO2Incubate for 48h;

[0084]After T cells are activated for 48 hours, demagnetize the beads, centrifuge at 300g for 5 min, remove the supernatant, resuspend the T cells in fresh medium, add recombinant lentivirus expressing CAR, recombinant lentivirus expressing intact IL-7 and CCL19 or ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides an expression vector for co-expressing secretory IL-7 and selective CCL19 and an application of the expression vector. The expression vector comprises an IL-6 signal peptide coding gene, an IL-7 coding gene, an NFAT regulatory promoter and a CCL19 coding gene. In the expression vector disclosed by the invention, the coding gene of IL-6 signal peptide is added to the upstreamof the IL-7 coding gene, so that secretory expression of the IL-7 by T cells is realized. The NFAT regulatory promoter is adopted as the promoter of the CCL19 coding gene, selective expression of theCCL19 by the T cells is realized, and the proliferation ability and tumor cell killing efficiency of CAR-T cells containing the expression vector are significantly improved.

Description

Technical field[0001]The invention belongs to the technical field of biomedicine, and relates to an expression vector for co-expressing secreted IL-7 and selective CCL19 and its application.Background technique[0002]Chimeric antigen receptor T cell (CAR-T) immunotherapy is a cellular immunotherapy method based on chimeric antigen receptors. Through in vitro gene transfer technology, the coded chimeric antigen is received The gene sequence of CAR (CAR) is transferred into T cells to generate tumor-specific T cells that can bind to the target antigen.[0003]In recent years, CAR-T therapy has achieved remarkable results in the treatment of hematological malignancies. The US FDA has approved two CD19-targeted CAR-T cell products for the market, and many domestic companies have also launched CD19 targets. Clinical Trials. However, the poor effect of CAR-T cells in the treatment of solid tumors is mainly due to the lack of suitable target antigens, the short duration of CAR-T cells in the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/867C12N15/62C12N15/19C12N5/10A61K39/00A61P35/00
CPCC12N15/86C07K14/5412C07K14/5418C07K14/523C07K16/2821C07K14/7051C12N5/0636A61K39/00114A61K39/001142A61K39/001168A61P35/00C12N2740/15043C12N2800/107C07K2317/622C07K2319/02C07K2319/03C07K2319/33C07K2319/74C12N2510/00A61K2039/5156
Inventor 汤朝阳秦乐吴迪魏志辉王翠花王艳艳其他发明人请求不公开姓名
Owner GUANGDONG ZHAOTAI INVIVO BIOMEDICINE CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap