A method for co-expressing phospholipase to promote extracellular expression of protein in Bacillus subtilis
A technology of Bacillus subtilis and phospholipase, which is applied in the fields of genetic engineering, enzyme engineering, and microbial engineering, can solve the problems of insignificant effect and poor extracellular secretion of target protein, and achieve the effect of cost saving and simplification of downstream purification process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0043] Example 1: Construction of the recombinant plasmid pHY300PLK-treS-pld1 co-expressed with phospholipase and trehalose synthase
[0044]Using the plasmid pHYPULd4P (containing the pullulanase pul and chaperone prsA genes, see Jiangnan University Zhang Kang’s doctoral dissertation, 2018) as a template, design forward and reverse primers (pHY300PLK-F1: 5'-AAGCTTGGTAATAAAAAAAACACCTCC- 3' and pHY300PLK-R1: 5'-TCTTGACACTCCTTATTTGATTTTT-3'), amplified expression vector pHY300PLK-prsA fragment; with plasmid pET24a(+)-TreS (published in Luo Feng, Duan Xuguo, Su Lingqia, Wu Jing, Thermobifida fusca Cloning, expression and fermentation optimization of trehalose synthase gene, Chinese Journal of Biotechnology, 2013, 33(8):98-104) as a template, respectively designed forward and reverse primers (treS-F: GGAGTGTCAAGAATGACCACACAGCCGGCTCC and treS-R: TTTATTACCAAGCTTTCAGGACCGCTGGGTCGGGTCG ), amplify the trehalose synthase gene fragment (as shown in SEQ ID NO.6); connect the expression ve...
Embodiment 2
[0047] Example 2: Construction of T.fusca phospholipase and trehalose synthase co-expression recombinant bacteria
[0048] Preparation of competent cells: Dip the frozen Bacillus subtilis WS5 with an inoculation loop, then streak on the LB plate, culture overnight at 37°C for activation; pick a single colony and inoculate in 10mL LB liquid medium, overnight at 37°C, 200rpm Cultivate for 8 hours; transfer 2.5 mL into 40 mL of LB medium containing 0.5 M sorbitol, and incubate at 37°C with shaking at 200 rpm for 4 to 5 hours; bathe the bacteria in ice water for 10 minutes, then centrifuge at 5,000 rpm at 4°C for 5 minutes to collect the bacteria. Resuspend the cells with 50 mL of pre-cooled electroporation buffer, centrifuge at 5000 rpm at 4°C for 5 minutes, remove the supernatant, and rinse 4 times in this way; resuspend the washed cells in 1 mL electroporation medium, and distribute them into 1.5 mL EP tubes , 200 μL per tube.
[0049] Transformation of competent cells: Add th...
Embodiment 3
[0055] Example 3: Shake flask fermentation of recombinant Bacillus subtilis and expression of trehalose synthase
[0056] The recombinant Bacillus subtilis WS5 pHY300PLK-treS-pld1 and the recombinant Bacillus subtilis WS5 pHY300PLK-treS constructed in Example 2 and Comparative Document 1 were respectively inoculated in the seed medium and cultured at 35-38°C and 180-220rpm for 8 ~10h, get the seed solution, then transfer the seed solution to the fermentation medium with 5% inoculation amount, so that the order of the bacteria after inoculation is 1×10 6 CFU / mL, cultured at 33°C, 200rpm for 24h, then at 12000r·min -1 After centrifuging for 10 min, the fermentation supernatant was obtained, and the activity of trehalose synthase was detected.
[0057] Trehalose synthase enzyme activity detection method: Take 400 μl of the enzyme solution diluted to an appropriate multiple, add 400 μl of 5% (w / v) maltose solution prepared with 20mmol / L, pH7.0 phosphate buffer, and react the mixe...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More