A method for co-expressing phospholipase to promote extracellular expression of protein in Bacillus subtilis

A technology of Bacillus subtilis and phospholipase, which is applied in the fields of genetic engineering, enzyme engineering, and microbial engineering, can solve the problems of insignificant effect and poor extracellular secretion of target protein, and achieve the effect of cost saving and simplification of downstream purification process

Active Publication Date: 2022-05-10
JIANGNAN UNIV
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the effect of this enzyme on promoting extracellular secretion does not have an effect on any enzyme, and the effect on promoting secretion of enzymes with a large molecular weight such as isoamylase is not obvious
On the other hand, when this technology is applied to the Bacillus subtilis expression system, that is, when the recombinant protein is co-expressed with Bacillus cereus-derived phospholipase C in Bacillus cereus, the extracellular secretion of the target protein is not effective. Therefore, it is necessary to It is more suitable for the co-expression of phospholipase of Bacillus subtilis host bacteria and the target protein to achieve the extracellular production of the target protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1: Construction of the recombinant plasmid pHY300PLK-treS-pld1 co-expressed with phospholipase and trehalose synthase

[0044]Using the plasmid pHYPULd4P (containing the pullulanase pul and chaperone prsA genes, see Jiangnan University Zhang Kang’s doctoral dissertation, 2018) as a template, design forward and reverse primers (pHY300PLK-F1: 5'-AAGCTTGGTAATAAAAAAAACACCTCC- 3' and pHY300PLK-R1: 5'-TCTTGACACTCCTTATTTGATTTTT-3'), amplified expression vector pHY300PLK-prsA fragment; with plasmid pET24a(+)-TreS (published in Luo Feng, Duan Xuguo, Su Lingqia, Wu Jing, Thermobifida fusca Cloning, expression and fermentation optimization of trehalose synthase gene, Chinese Journal of Biotechnology, 2013, 33(8):98-104) as a template, respectively designed forward and reverse primers (treS-F: GGAGTGTCAAGAATGACCACACAGCCGGCTCC and treS-R: TTTATTACCAAGCTTTCAGGACCGCTGGGTCGGGTCG ), amplify the trehalose synthase gene fragment (as shown in SEQ ID NO.6); connect the expression ve...

Embodiment 2

[0047] Example 2: Construction of T.fusca phospholipase and trehalose synthase co-expression recombinant bacteria

[0048] Preparation of competent cells: Dip the frozen Bacillus subtilis WS5 with an inoculation loop, then streak on the LB plate, culture overnight at 37°C for activation; pick a single colony and inoculate in 10mL LB liquid medium, overnight at 37°C, 200rpm Cultivate for 8 hours; transfer 2.5 mL into 40 mL of LB medium containing 0.5 M sorbitol, and incubate at 37°C with shaking at 200 rpm for 4 to 5 hours; bathe the bacteria in ice water for 10 minutes, then centrifuge at 5,000 rpm at 4°C for 5 minutes to collect the bacteria. Resuspend the cells with 50 mL of pre-cooled electroporation buffer, centrifuge at 5000 rpm at 4°C for 5 minutes, remove the supernatant, and rinse 4 times in this way; resuspend the washed cells in 1 mL electroporation medium, and distribute them into 1.5 mL EP tubes , 200 μL per tube.

[0049] Transformation of competent cells: Add th...

Embodiment 3

[0055] Example 3: Shake flask fermentation of recombinant Bacillus subtilis and expression of trehalose synthase

[0056] The recombinant Bacillus subtilis WS5 pHY300PLK-treS-pld1 and the recombinant Bacillus subtilis WS5 pHY300PLK-treS constructed in Example 2 and Comparative Document 1 were respectively inoculated in the seed medium and cultured at 35-38°C and 180-220rpm for 8 ~10h, get the seed solution, then transfer the seed solution to the fermentation medium with 5% inoculation amount, so that the order of the bacteria after inoculation is 1×10 6 CFU / mL, cultured at 33°C, 200rpm for 24h, then at 12000r·min -1 After centrifuging for 10 min, the fermentation supernatant was obtained, and the activity of trehalose synthase was detected.

[0057] Trehalose synthase enzyme activity detection method: Take 400 μl of the enzyme solution diluted to an appropriate multiple, add 400 μl of 5% (w / v) maltose solution prepared with 20mmol / L, pH7.0 phosphate buffer, and react the mixe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for co-expressing phospholipase to promote the extracellular expression of protein in Bacillus subtilis, belonging to the technical fields of bioengineering, enzyme engineering and microbial engineering. In the present invention, phospholipase and target protein are co-expressed in Bacillus subtilis, which can realize intracellular localization and extracellular expression of the target protein, can make the extracellular secretion of trehalose synthase reach 5.8-6.2 U / mL, and make the branching enzyme The amount of exocrine reaches 456-580U / mL, improves production efficiency, simplifies the extraction process, and provides an application basis for large-scale production of the target protein, which has high academic significance and application value.

Description

technical field [0001] The invention relates to a method for co-expressing phospholipase to promote the extracellular expression of proteins in Bacillus subtilis, belonging to the technical fields of genetic engineering, enzyme engineering and microbial engineering. Background technique [0002] Bacillus subtilis is a Gram-positive bacterium, which has the advantages of non-pathogenicity, good environmental compatibility, and is not easy to produce drug resistance. It also has a good fermentation foundation, and its cultivation is simple and fast. It has been approved by the US Food and Drug Administration and China. Relevant departments have identified it as a food safety grade strain GRAS (Generally recognized as safe), and it is currently widely used in the production of various industrial enzymes. [0003] Extracellular expression can simplify the downstream purification process and save costs, so it has absolute advantages in large-scale industrial production. However,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/18C12N9/16C12N1/21C12N15/75C12N9/10C12N9/90C12R1/125
CPCC12N9/18C12N9/16C12N15/75C12N9/107C12N9/1051C12N9/90C12Y204/01C12Y204/01245C12Y204/01018C12Y503/01005
Inventor吴敬宿玲恰黄燕
OwnerJIANGNAN UNIV