Phenylalanine ammonia lyase gene ThPAL derived from radix tetrastigme and application thereof
A technology of phenylalanine ammonia lyase and gene, which is applied in the field of phenylalanine ammonia lyase gene ThPAL and its application, can solve the problem of relatively little research at the molecular level
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1 3
[0025] Example 1 Obtaining the full-length sequence of the ThPAL gene cDNA of Sanyeqingqing
[0026] The leaves of the fresh plants of cloverleaf were taken, wrapped in tin foil, and quickly frozen with liquid nitrogen, and total RNA was extracted and reverse transcribed into cDNA. Total RNA was extracted according to the instructions of TIANGEN RNAprep Pure Plant Total RNA Extraction Kit (DP441), and its integrity and concentration were detected by 1.0% agarose gel electrophoresis and nucleic acid concentration detector.
[0027] Reverse transcription of total RNA according to Takara PrimeScript TM II 1st Strand cDNA Synthesis Kit instructions.
[0028] Based on the existing transcriptome data and the PAL gene sequences of the same family and genus in NCBI, BLAST analysis was performed, and the sequence with the highest similarity was selected as the target gene sequence, and multiple pairs of primers were designed based on the open reading frame sequence of this sequence. ...
Embodiment 2
[0033] Example 2 Secondary structure and tertiary structure prediction of ThPAL and phylogenetic tree analysis
[0034] Using the online software SOPMA (https: / / npsa-prabi.ibcp.fr / cgi-bin / npsa_automat.pl?page=npsa_sopma.html) to predict the secondary structure of ThPAL protein in the biosynthetic pathway of resveratrol, the results like figure 2 As shown, the protein consists of 54.07% Alpha helix, 8.43% Extended strand, 5.34% Beta turn and 32.16% Random coil, It shows that the α-helical structure is the backbone of the secondary structure of protein PAL.
[0035]The online software SWISS-MODEL (http: / / swissmodel.expasy.org / ) was used to predict the three-dimensional structure of ThPAL protein in the biosynthetic pathway of resveratrol. The method was X-ray, and the resolution was The result is as image 3 shown. The template number used is 1w27.1.A, the sequence identity (Seq Identity) is 85.19%, the oligo-state (Oligo-state) is Homo-tetramer (homotetramer), and the seq...
Embodiment 3
[0044] Example 3 Functional verification of ThPAL gene
[0045] The cDNA sequence of ThPAL gene and the distribution of restriction sites on the plasmid vector pCMBIA1301 were analyzed, and PCR primers with SmaI and XbaI restriction sites (upstream primer: TCCCCCGGGATGGAAGCAAAGAACTGCAATGG; downstream primer: GCTCTAGATTAGCAGATCGGGAGT GGAGCA) were designed for Construction of overexpression vectors.
[0046] The cloverleaf cDNA was used as a template for PCR amplification. The reaction system was the same as above. After the amplification product was subjected to 1.0% agarose gel electrophoresis, the DNA fragment consistent with the target gene was purified and recovered by a kit. The purified and recovered product was double digested with plasmid pCMBIA1301 at 37°C, and then purified and recovered by agarose gel electrophoresis. The purified and recovered digested products were ligated with T4 DNA ligase and incubated at 16°C overnight. The ligation system was: 2 μL plasmid ve...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


