Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cinnamic acid-4-hydroxylase gene thc4h and its application

A technology of hydroxylase and cinnamic acid, applied in the field of genetic engineering, can solve the problems of relatively little research at the molecular level

Active Publication Date: 2022-06-07
HANGZHOU SANYEQING AGRI TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the research on Clover mainly focuses on cultivation, seedling cultivation, extraction and separation of chemical components and pharmacological effects, etc., and there are few studies on its molecular level.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cinnamic acid-4-hydroxylase gene thc4h and its application
  • Cinnamic acid-4-hydroxylase gene thc4h and its application
  • Cinnamic acid-4-hydroxylase gene thc4h and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1 3

[0025] Example 1 Acquisition of the full-length sequence of the ThC4H gene cDNA of cloverleaf

[0026] The leaves of the fresh plants of cloverleaf were taken, wrapped in tin foil, and quickly frozen with liquid nitrogen, and total RNA was extracted and reverse transcribed into cDNA. Total RNA was extracted according to the instructions of TIANGEN RNAprep Pure Plant Total RNA Extraction Kit (DP441), and its integrity and concentration were detected by 1.0% agarose gel electrophoresis and nucleic acid concentration detector.

[0027] Reverse transcription of total RNA according to Takara PrimeScript TM II 1st Strand cDNA Synthesis Kit instructions.

[0028] Based on the existing transcriptome data and the C4H gene sequence of the same family and genus in NCBI, BLAST analysis was performed, and the sequence with the highest similarity was selected as the target gene sequence, and multiple pairs of primers were designed based on the open reading frame sequence of this sequence....

Embodiment 2

[0034] Embodiment 2 The secondary structure and tertiary structure prediction of ThC4H and phylogenetic tree analysis

[0035] Using the online software SOPMA (https: / / npsa-prabi.ibcp.fr / cgi-bin / npsa_automat.pl?page=npsa_sopma.html) to predict the secondary structure of ThC4H protein in the biosynthetic pathway of resveratrol, the results like figure 2 As shown, the protein consists of 47.92% Alpha helix, 12.87% Extended strand, 4.55% Beta turn and 34.65% Random coil, The α-helical structure is the backbone of the secondary structure of protein C4H.

[0036]The online software SWISS-MODEL (http: / / swissmodel.expasy.org / ) was used to predict the three-dimensional structure of ThC4H protein in the biosynthetic pathway of resveratrol. The method was X-ray, and the resolution was The result is as image 3 shown. The template number used is 6vby.1.A, the sequence identity (Seq Identity) is 75.25%, the state of the oligonucleotide (Oligo-state) is Monomer (monomer), and the seq...

Embodiment 3

[0043] Example 3 Functional verification of ThC4H gene

[0044] The cDNA sequence of ThC4H gene and the distribution of restriction sites on the plasmid vector pCMBIA1301 sequence were analyzed, and PCR primers with SmaI and XbaI restriction sites (upstream primer: TCCCCCGGGATGGATCTCATACTCATCG; downstream primer: GCTCTAGATCAAGCTTCTATTGCTTTG) were designed for the construction of overexpression vector.

[0045] The cloverleaf cDNA was used as a template for PCR amplification. The reaction system was the same as above. After the amplification product was subjected to 1.0% agarose gel electrophoresis, the DNA fragment consistent with the target gene was purified and recovered by a kit. The purified and recovered product was double digested with plasmid pCMBIA1301 at 37°C, and then purified and recovered by agarose gel electrophoresis. The purified and recovered digested products were ligated with T4 DNA ligase and incubated at 16°C overnight. The ligation system was: 2 μL plasmi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cinnamic acid-4-hydroxylase gene ThC4H derived from Clover and its application. The nucleotide sequence of the cinnamic acid-4-hydroxylase gene ThC4H is shown in SEQ ID NO.1 . The present invention uses clover as a biological source to design primers to amplify its cDNA sequence, and obtains the cinnamic acid-4-hydroxylase gene ThC4H, which is one of the key enzymes in the phenylpropane metabolic pathway and can be used to produce white Veratrol.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, and mainly relates to a cinnamic acid-4-hydroxylase gene ThC4H derived from cloverleaf and application thereof. Background technique [0002] As the state attaches great importance to traditional Chinese medicine in recent years, the government's strong support has driven the rapid development of the traditional Chinese medicine industry and expanded the market demand for Tetrastigma hemsleyanum Diels et Gilg. The continuous in-depth research on the anti-tumor effect of cloverleaf has led to a rapid increase in the market price of cloverleaf in recent years, and its market demand is also increasing. [0003] In recent years, the gene regulation of the synthesis of secondary metabolites in medicinal plants has become a very active frontier research field in molecular biology. The amount and composition of metabolites mainly depend on the key enzymes of biosynthesis and their expression...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/53C12N9/02C12N15/70C12N1/21C12P7/22C12R1/19
CPCC12N9/0073C12N15/70C12P7/22C12Y114/13011
Inventor 夏鹏国胡婉莹张宇杨东风章彩娟梁宗锁
Owner HANGZHOU SANYEQING AGRI TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com