Resveratrol synthase gene RS derived from tetrastigma hemsleyanum diels et gilg and application thereof
A technology of resveratrol synthase and resveratrol, which is applied in the field of genetic engineering and can solve the problems of relatively little research at the molecular level
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1 3
[0025] Example 1 Acquisition of the full-length sequence of the ThRS gene cDNA of Clover
[0026] The leaves of fresh plants of Clover were taken, wrapped in tin foil, and quickly frozen with liquid nitrogen, total RNA was extracted, and reverse transcribed into cDNA. Total RNA was extracted according to the instructions of TIANGEN RNAprep Pure Plant Total RNA Extraction Kit (DP441), and its integrity and concentration were detected by 1.0% agarose gel electrophoresis and a nucleic acid concentration detector.
[0027] Reverse transcription of total RNA according to Takara PrimeScript TM II 1st Strand cDNA Synthesis Kit instructions.
[0028] According to the existing transcriptome data and the RS gene sequence of the same family and genus in NCBI, BLAST analysis was carried out, and the sequence with the highest similarity was selected as the target gene sequence, and several pairs of primers were designed with the open reading frame sequence of this sequence as a template. ...
Embodiment 2
[0033] Example 2 Secondary structure and tertiary structure prediction and phylogenetic tree analysis of ThRS
[0034] Using the online software SOPMA (https: / / npsa-prabi.ibcp.fr / cgi-bin / npsa_automat.pl?page=nps a_sopma.html) to predict the secondary structure of ThRS protein in the resveratrol biosynthetic pathway, the results As shown in Figure 2, the protein consists of 45.93% α-helix (Alpha helix), 15.99% extended chain (Extended strand d), 6.40% β-turn (Beta turn) and 31.69% random coil (Random coil ), indicating that the α-helical structure is the backbone of the secondary structure of the protein RS.
[0035] Use the online software SWISS-MODEL (http: / / swissmodel.expasy.org / ) to predict the three-dimensional structure of the ThRS protein in the resveratrol biosynthesis pathway. The method used is X-ray, and the resolution is The result is as image 3 shown. The template number used is 3tsy.1.A, the sequence identity (Seq Identity) is 92.73%, the state of the oligonucl...
Embodiment 3
[0039] Example 3 Functional verification of the ThrRS gene
[0040] The cDNA sequence of the ThRS gene and the distribution of restriction sites on the plasmid vector pCMBIA1301 were analyzed, and PCR primers with SmaI and XbaI restriction sites were designed (upstream primer: TCCCCCGGGATGACTGAGTTGAAGAAG; downstream primer: GCTCTAGATTAAGTTGAGATTGTAGG) for constructing overexpression vector.
[0041] Clover cDNA was used as a template for PCR amplification, and the reaction system was the same as above. After the amplified product was subjected to 1.0% agarose gel electrophoresis, a kit was used to purify and recover the DNA fragment consistent with the target gene. The purified recovered product and the plasmid pCMBIA1301 were subjected to double enzyme digestion at 37°C, followed by agarose gel electrophoresis and then purified and recovered. The purified and recovered digested products were ligated with T4 DNA ligase and incubated overnight at 16°C. The ligation system was:...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


