4-coumarate-CoA ligase gene Th4CL and application thereof
A technology of ligase and coumaric acid, which is applied in the field of genetic engineering and can solve the problems of relatively few studies at the molecular level.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1 3
[0025] Example 1 Acquisition of the full-length cDNA sequence of A. trifoliate Th4CL gene
[0026] The leaves of fresh plants of Clover were taken, wrapped in tin foil, and quickly frozen with liquid nitrogen, total RNA was extracted, and reverse transcribed into cDNA. Total RNA was extracted according to the instructions of TIANGEN RNAprep Pure Plant Total RNA Extraction Kit (DP441), and its integrity and concentration were detected by 1.0% agarose gel electrophoresis and a nucleic acid concentration detector. Reverse transcription of total RNA according to Takara PrimeScript TM II 1st Strand cDNA Synthesis Kit instructions.
[0027] According to the existing transcriptome data and the 4CL gene sequence of the same family and genus in NCBI, BLAST analysis was carried out, and the sequence with the highest similarity was selected as the target gene sequence, and several pairs of primers were designed with the open reading frame sequence of this sequence as a template, two of ...
Embodiment 2
[0033] Example 2 Secondary structure and tertiary structure prediction and phylogenetic tree analysis of Th4CL
[0034]Using the online software SOPMA (https: / / npsa-prabi.ibcp.fr / cgi-bin / npsa_automat.plpage=npsa_sopma.html) to predict the secondary structure of Th4CL protein in the resveratrol biosynthesis pathway, the results are as follows figure 2 As shown, the protein is composed of 30.47% α-helix (Alpha helix), 18.56% extended chain (Extended st rand), 7.88% β-turn (Beta turn) and 43.08% random coil (Randomcoil), It shows that the random coil structure is the skeleton of the secondary structure of protein Th4CL.
[0035] Use the online software SWISS-MODEL (http: / / swissmodel.expasy.org / ) to predict the three-dimensional structure of Th4CL protein in the resveratrol biosynthesis pathway, using X-ray, the resolution is The result is as image 3 shown. The template number used is 5bsm.1.A, the sequence identity (Seq Identity) is 66.60%, the state of the oligonucleotide ...
Embodiment 3
[0042] Example 3 Functional verification of Th4CL gene
[0043] The cDNA sequence of the Th4CL gene and the distribution of restriction sites on the plasmid vector pCMBIA1301 were analyzed, and PCR primers with SmaⅠ and XbaⅠ restriction sites were designed (upstream primer: TCCCCCGGGATGATTTCCATTGAAACC; downstream primer: GCTCTAGATTAATTTGTCCCTGGGATCTTC) for the construction of overexpression vector.
[0044] Clover cDNA was used as a template for PCR amplification, and the reaction system was the same as above. After the amplified product was subjected to 1.0% agarose gel electrophoresis, a kit was used to purify and recover the DNA fragment consistent with the target gene. The purified recovered product and the plasmid pCMBIA1301 were subjected to double enzyme digestion at 37°C, followed by agarose gel electrophoresis and then purified and recovered. The purified and recovered digested products were ligated with T4 DNA ligase and incubated overnight at 16°C. The ligation sys...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



