Unlock instant, AI-driven research and patent intelligence for your innovation.

4-coumarate-CoA ligase gene Th4CL and application thereof

A technology of ligase and coumaric acid, which is applied in the field of genetic engineering and can solve the problems of relatively few studies at the molecular level.

Active Publication Date: 2021-02-26
HANGZHOU SANYEQING AGRI TECH
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the research on Clover mainly focuses on cultivation, seedling cultivation, extraction and separation of chemical components and pharmacological effects, etc., and there are few studies on its molecular level.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 4-coumarate-CoA ligase gene Th4CL and application thereof
  • 4-coumarate-CoA ligase gene Th4CL and application thereof
  • 4-coumarate-CoA ligase gene Th4CL and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1 3

[0025] Example 1 Acquisition of the full-length cDNA sequence of A. trifoliate Th4CL gene

[0026] The leaves of fresh plants of Clover were taken, wrapped in tin foil, and quickly frozen with liquid nitrogen, total RNA was extracted, and reverse transcribed into cDNA. Total RNA was extracted according to the instructions of TIANGEN RNAprep Pure Plant Total RNA Extraction Kit (DP441), and its integrity and concentration were detected by 1.0% agarose gel electrophoresis and a nucleic acid concentration detector. Reverse transcription of total RNA according to Takara PrimeScript TM II 1st Strand cDNA Synthesis Kit instructions.

[0027] According to the existing transcriptome data and the 4CL gene sequence of the same family and genus in NCBI, BLAST analysis was carried out, and the sequence with the highest similarity was selected as the target gene sequence, and several pairs of primers were designed with the open reading frame sequence of this sequence as a template, two of ...

Embodiment 2

[0033] Example 2 Secondary structure and tertiary structure prediction and phylogenetic tree analysis of Th4CL

[0034]Using the online software SOPMA (https: / / npsa-prabi.ibcp.fr / cgi-bin / npsa_automat.plpage=npsa_sopma.html) to predict the secondary structure of Th4CL protein in the resveratrol biosynthesis pathway, the results are as follows figure 2 As shown, the protein is composed of 30.47% α-helix (Alpha helix), 18.56% extended chain (Extended st rand), 7.88% β-turn (Beta turn) and 43.08% random coil (Randomcoil), It shows that the random coil structure is the skeleton of the secondary structure of protein Th4CL.

[0035] Use the online software SWISS-MODEL (http: / / swissmodel.expasy.org / ) to predict the three-dimensional structure of Th4CL protein in the resveratrol biosynthesis pathway, using X-ray, the resolution is The result is as image 3 shown. The template number used is 5bsm.1.A, the sequence identity (Seq Identity) is 66.60%, the state of the oligonucleotide ...

Embodiment 3

[0042] Example 3 Functional verification of Th4CL gene

[0043] The cDNA sequence of the Th4CL gene and the distribution of restriction sites on the plasmid vector pCMBIA1301 were analyzed, and PCR primers with SmaⅠ and XbaⅠ restriction sites were designed (upstream primer: TCCCCCGGGATGATTTCCATTGAAACC; downstream primer: GCTCTAGATTAATTTGTCCCTGGGATCTTC) for the construction of overexpression vector.

[0044] Clover cDNA was used as a template for PCR amplification, and the reaction system was the same as above. After the amplified product was subjected to 1.0% agarose gel electrophoresis, a kit was used to purify and recover the DNA fragment consistent with the target gene. The purified recovered product and the plasmid pCMBIA1301 were subjected to double enzyme digestion at 37°C, followed by agarose gel electrophoresis and then purified and recovered. The purified and recovered digested products were ligated with T4 DNA ligase and incubated overnight at 16°C. The ligation sys...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a 4-coumarate-CoA ligase gene Th4CL derived from tetrastigma hemsleyanum Diels et Gilg and an application of the 4-coumarate-CoA ligase gene Th4CL. The nucleotide sequence of the 4-coumarate-CoA ligase gene Th4CL is shown as SEQ ID NO.1. The tetrastigma hemsleyanum Diels et Gilg is used as a biological source design primer to amplify the cDNA sequence of the tetrastigma hemsleyanum Diels et Gilg to obtain the 4-coumarate-CoA ligase gene Th4CL, and the gene is used as one of key enzymes in a phenylpropane metabolic pathway and can be used for producing resveratrol.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, and mainly relates to a 4-coumaric acid-coenzyme A ligase gene Th4CL derived from cloverleaf and its application. Background technique [0002] In recent years, the country has attached great importance to traditional Chinese medicine and the government's strong support has driven the rapid development of the Chinese medicine industry and expanded the market demand for Tetrastigma hemsleyanum Diels et Gilg. The continuous deepening of research on the anti-tumor effect of cloverleaf has led to a rapid increase in the market price of cloverleaf in recent years, and its market demand is also increasing. [0003] In recent years, the gene regulation of the synthesis of medicinal plant secondary metabolites has become a very active frontier research field in molecular biology. The amount and composition of metabolites mainly depend on the key enzymes of biosynthesis and the expression leve...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/52C12N9/00C12N15/70C12N1/21C12P7/22C12R1/19
CPCC12N9/93C12Y602/01012C12N15/70C12P7/22
Inventor 夏鹏国胡婉莹许玲郑宇婕李倩倩梁宗锁
Owner HANGZHOU SANYEQING AGRI TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More