Unlock instant, AI-driven research and patent intelligence for your innovation.

Plasmid and its constitution method and application in determining HIV carrying amount

An HIV and plasmid technology, applied in biological testing, measuring devices, introducing foreign genetic material using vectors, etc., can solve the problems of difficult clinical and scientific research, high technical requirements, and expensive detection kits, and achieves good specificity. , high sensitivity, simple operation effect

Inactive Publication Date: 2003-10-08
KUNMING INST OF ZOOLOGY CHINESE ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The test kit is expensive (between $200 and $500 per sample) and technically demanding
Some existing methods can only be carried out in a very small number of laboratories, so it is difficult to be widely used in clinical and scientific research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plasmid and its constitution method and application in determining HIV carrying amount
  • Plasmid and its constitution method and application in determining HIV carrying amount
  • Plasmid and its constitution method and application in determining HIV carrying amount

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0019] Below in conjunction with accompanying drawing, technical scheme of the present invention is described in further detail:

[0020] The plasmid is pSPgag737 / JM109 CGMCC NO.0486 containing the human HIV core antigen gene and using Escherichia coli JM109 as the carrier bacterium. The reason why this plasmid is identified as pSPgag737 is that HIV-1 gag gene fragment is inserted into its genome. Its taxonomic properties contain the SP6 RNA polymerase promoter and (dA:dT) 30 of plasmids. The relevant literature used as a judgment standard is GenBank / EMBL Accession Number: X65328.

[0021] 1. Construction of pSPgag737 plasmid

[0022] Using primers GAG1 (upstream, 5'GCAACCCTCTTAT TGTGTG3', 1043-1060) / GAG2 (downstream, 5'CCAACAAGGTTTCTGTCATC3', 1763-1744) to amplify the proviral DNA of 8E5 cells with the introduction of Sal I and Sac I restriction sites, respectively, After double digestion with Sal I and Sac I, the digested fragment was recovered and purified by low-meltin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention belongs to the field of preventing and treating AIDS. The plasmid pSPgag737 / JM109 CGMCC No.0486 is constituted through the processes of double enzyme incision of HIV-1 provirus DNA with Sal I / sac I, viscid end connection with double enzyme incised pSP64Poly(A) plasmid to obtain recombinant pSPgag737 plasmid containing HIV-1 gag gene segment, converting to JM109 competent cell, enzyme incision / PCR qualification to obtain positive clonor, and in vitro transferring the positive clonor to obtain outer RNA reference for quantitative test of virus carrying amount. The present invention establishes the method of quantitatively testing virus carrying amount in plasma of HIV infector and AIDS sufferer by combining PCR technology and Kodak electrophoresis atlas analysis system. The present invention is simple, cheap, good in specificity, high in sensitivity and high in repeatability, and may be used in the scientific research and prevention and treatment of AIDS.

Description

Technical field: [0001] The invention relates to a plasmid, its construction method and its application in HIV load determination, belonging to the field of AIDS prevention and treatment. Background technique: [0002] AIDS (AIDS) is a fatal disease caused by human immunodeficiency virus type 1 (HIV-1) that destroys the body's immune system. Since the first case of AIDS was discovered in my country in 1985, the disease has spread rapidly across the country and has entered a period of rapid growth. The prevention and treatment of AIDS has become a major issue related to the national economy and people's livelihood. The clinical treatment of AIDS, and the discovery and research of new anti-AIDS drugs and vaccines require an objective and reliable indicator to judge the course and prognosis of HIV-infected patients. Existing methods such as serum p24 antigen level detection, reverse transcriptase activity measurement, and virus isolation and culture can also reflect changes in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/10C12N15/63C12Q1/68G01N33/53G01N33/569G01N33/577
Inventor 贲昆龙夏雪山徐焕宾冯汉平
Owner KUNMING INST OF ZOOLOGY CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More