Method for efficiently repairing gene mutation of ring-like sideroblastic anemia

A gene and mutation sequence technology, which is applied in the field of efficient repair of ring sideroblastic anemia gene mutations, can solve problems such as treatment options for unreported diseases, and achieve the effects of reconstruction, normal differentiation function, and promotion of differentiation

Pending Publication Date: 2021-03-05
EDIGENE GUANGZHOU INC +1
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] However, although the research on disease genetics and pathogenesis of XLSA is relatively mature, so far, no effective treatment plan for this disease has been reported at home and abroad, and the use of gene editing technology to develop a new cell therapy technology for this disease is difficult Bringing new hope for disease treatment of XLSA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for efficiently repairing gene mutation of ring-like sideroblastic anemia
  • Method for efficiently repairing gene mutation of ring-like sideroblastic anemia
  • Method for efficiently repairing gene mutation of ring-like sideroblastic anemia

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0175] Example 1: Efficient gene repair of ALAS-2 intron-1 point mutation in hiPSCs derived from XLSA patients

[0176] This example involves the use of the CRISPR / Cas9 system to gene-edit XLSA patient-derived human induced pluripotent stem cells (Human induced pluripotent stem cells, hiPSCs) to efficiently repair the ALAS-2 intron-1 point mutation at (X:55054635 [Chr X(GRCh37 / hg19):g.55054635A>G, NM 000032.4:c.-15–2187T>C), since this site is the junction of GATA-1 and ALAS-2 genes, this point is mutated Named Int-1-GATA.

[0177] In order to repair disease mutations, first use the "CRISPR RGEN TOOLS" software to design sgRNA targeting the genome near the Int-1-GATA mutation site and synthesize three chemically modified sgRNAs, wherein the sgRNA contains a sequence complementary to the target sequence The coding information is as follows: sgRNA-1: aactctggcaactttacctg (SEQ ID NO: 1), sgRNA-2: caactttacctgtggtctgc (SEQ ID NO: 2), sgRNA-3: gggctgagcctgcagaccac (SEQ ID NO: 3)...

Embodiment 2

[0189] Example 2 Efficient Gene Repair of ALAS-2 Intron-1 Point Mutation in CD34+ HSPCs from Bone Marrow of XLSA Patients

[0190] In Example 1, we achieved efficient repair of the Int-1-GATA point mutation of XLSA-derived hiPSCs, referring to the amount of Cas9 mRNA, sgRNA-1 and ssODN added in Example 1, in this experiment we tried gene repair CD34+ HSPC derived from bone marrow of XLSA patients.

[0191] Select the electroporation conditions of 300v 1ms, electrotransfer the amount of different Cas9 mRNA, sgRNA-1 and ssODN into the CD34+HSPC derived from the bone marrow of XLSA patients, and the Cas9 mRNA:sgRNA-1:ssODN added in every 1.0*10^6 cells is 6 μg: 4 μg: 6 μg and 6 μg: 4 μg: 10 μg, after 4 days, the genome of the HSPC was extracted, and the gene repair efficiency (HDR) and Indels efficiency (NHEJ) were analyzed by next-generation sequencing bioinformatics methods, such as Image 6 shown. The results showed that under the conditions of different addition amounts o...

Embodiment 3

[0193] Example 3 CD34+HSPC derived from XLSA patient's bone marrow after erythroid differentiation gene repair to evaluate cell phenotype Change

[0194] 3.1 Red blood cell differentiation

[0195] Referring to the amount of Cas9 mRNA, sgRNA-1 and ssODN found in Example 2 (6 μg: 4 μg: 12 μg), select the electroporation condition of 300v 1ms, and respectively electroporate Cas9 mRNA, sgRNA-1 and ssODN into the HSPC derived from the bone marrow of XLSA patients , erythroid differentiation experiments were performed using the "two-step" differentiation protocol described below. In addition, we erythroid differentiated CD34+ HSPCs from peripheral blood mobilized from healthy donors as a positive control.

[0196] The two-step method is to use HSPC erythroid expansion and differentiation medium for differentiation, and then use HSPC erythroid differentiation enucleation medium for differentiation.

[0197] Hematopoietic Stem Cell Erythroid Expansion and Differentiation Medi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for efficiently repairing ALAS-2 gene mutation causing ring-like sideroblastic anemia by using a gene editing technology. The method comprises the step of using the gene editing technology to carry out gene modification on specific point mutation of a gene ALAS-2 of a hematopoietic stem cell of a sufferer efficiently and safely and recover expression of the gene ALAS-2, ferroheme synthesis and erythrocyte aging can recover to normal levels, and the aim of treating diseases is achieved.

Description

technical field [0001] The present invention relates to the field of gene editing therapy. Specifically, the present invention relates to a method for efficiently repairing gene mutations leading to annular sideroblastic anemia by using gene editing technology, which includes using gene editing technology to genetically modify human hematopoiesis efficiently and safely The specific point mutation of ALAS-2 gene in stem cells restores the expression of ALAS-2 gene and achieves the purpose of treating diseases. Background technique [0002] Hereditary sideroblastic anemia (Congenital sideroblastic anemia, CSA) is a group of genetic disorders of iron utilization. It is characterized by a large number of ring sideroblasts in the bone marrow, ineffective production of red blood cells, excessive tissue iron stores, and microcytic hypochromic anemia in the peripheral blood. At present, 7 kinds of disease mutations have been found in molecular level detection, which mainly lead to ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/90C12N15/54C12N5/10
CPCC12N15/907C12N9/1029C12N5/0647C12N5/0696C12Y203/01037C12N2510/00
Inventor方日国袁鹏飞张英驰杨卉慧于玲玲
OwnerEDIGENE GUANGZHOU INC