Unlock instant, AI-driven research and patent intelligence for your innovation.

A thermal stability and high enzyme activity recombinant alginate lyase and its application

A technology of alginate lyase and algin oligosaccharides, which is applied in the field of alginate lyase, can solve the problems of unsatisfactory enzyme activity, low yield of alginate lyase, and improved thermal stability, so as to improve immunity, shorten enzyme Effect of solution time, high thermal stability

Active Publication Date: 2022-05-17
OCEAN UNIV OF CHINA +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the particularity of the marine environment, the yield of alginate lyase produced by marine microorganisms is low, and the enzyme activity cannot meet the needs of preparing alginate oligosaccharides
At present, many alginate lyases have been cloned and expressed, and their expression levels and enzyme activities have been improved compared with the original enzymes, but their enzymatic properties, such as thermal stability and enzyme activity, still need to be further improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A thermal stability and high enzyme activity recombinant alginate lyase and its application
  • A thermal stability and high enzyme activity recombinant alginate lyase and its application
  • A thermal stability and high enzyme activity recombinant alginate lyase and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1: Construction of mutants and their expression in Escherichia coli

[0026] In order to improve the thermal stability and activity of alginate lyase, the applicant modified the original alginate lyase with the following amino acid sequence:

[0027] MKVSCAVVLSACIASANADNNGDGKADSIKENDLNAGYADGTYFYTAADGGMVFRCPIDGYKTSTNTSYTRTELREMLRRGDTSIATQGVNGNNWVFGSAPASAREAAGGVDGVLRATLAVNHVTTTGDSGQVGRVIVGQIHANNDEPLRLYYRKLPGHSKGSVYIAHEPNGGSDSWYDMIGSRSSSASDPSDGIALDEVWSYEVKVVGNTLTVTIFRAGKDDVVQVVDMGNSGYDVADQYQYFKAGVYNQNNTGNASDYVQVTFYALEQSHD(SEQ ID NO:1)

[0028] The original alginate lyase, the nucleotide sequence of its coding gene is as follows:

[0029] ATGAAAGTAAGTTGCGCTGTCGTACTGTCTGCTTGTATTGCCAGTGCCAACGCAGACAACAATGGCGATGGCAAGGCCGACTCCATCAAGGAAAATGACCTGAATGCAGGCTATGCAGATGGCACCTACTTCTATACTGCTGCCGATGGCGGCATGGTGTTCCGCTGCCCGATCGATGGCTATAAAACATCGACCAACACGTCCTATACCCGCACCGAGCTGCGCGAGATGCTACGTCGTGGCGACACCAGCATTGCCACCCAGGGGGTCAATGGAAACAACTGGGTATTCGGCTCCGCACCCGCTTCGGCACGTGAAGCAGCCGGCGGTGTC...

Embodiment 2

[0054] Example 2: Expression of recombinant enzymes in Pichia pastoris

[0055] Using the plasmids HTa-cAlyM and HTa-D59C-A267C as templates, design primers to amplify the genes of the original enzyme and the modified enzyme. The primers are as follows:

[0056] EcoR Ⅰ-F: 5’-agagaggctgaagctgaattcATGAAAGTAAGTTGCGCTGTC-3’

[0057] Not Ⅰ-R: 5’-tgttctagaaagctggcggccgcTTAATCGTGCGACTGCTCCAG-3’

[0058] The amplification system is as follows:

[0059]

[0060]

[0061] The amplification conditions are as follows:

[0062]

[0063] After PCR amplification, use agarose gel electrophoresis at a concentration of 1% to verify whether the size and length of the PCR product bands are consistent with the target length, and then purify the PCR product with a PCR product purification kit. The pPICZαA empty plasmid stored in the laboratory was double digested with EcoRI and NotI, incubated in a water bath at 37°C for 1-3h, and inactivated at 80°C for 20min. The enzyme digestion sys...

Embodiment 3

[0077] Example 3: Preparation of Alginate Oligosaccharides

[0078] Dissolve alginate in water with pH=7.5 adjusted by NaOH, prepare 200mL alginate solution with a concentration of 6%, add 0.6mL or 0.8mL of recombinant alginate lyase D59C-A267C or cAlyM, and stir in a warm bath at 50°C for enzymolysis After 1.5h, add 0.2mL or 0.6mL of recombinant alginate lyase D59C-A267C or cAlyM, and continue enzymolysis at 50°C for 1h with stirring. The enzymolysis solution was centrifuged at 8000rpm for 10min to remove the residue, and the supernatant was the enzymolysis product.

[0079] The hydrolyzate of alginate lyase D59C-A267C was subjected to 4-fold alcohol precipitation to obtain the target product, and the crude product of algin oligosaccharide was obtained after the target product was rotary evaporated and freeze-dried, with a yield of 84.3%; oligosaccharides were determined by ESI-MS Polymerization degree and ESI-MS spectrum showed that the final products of enzymatic hydrolysi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a alginate lyase with better thermal stability and high enzyme activity, the amino acid sequence of which is SEQ ID NO:3 or SEQ ID NO5; the mutant enzyme provided by the present invention is used to prepare alginate oligosaccharides . The present invention utilizes the genetically modified recombinant alginate lyase to prepare algin oligosaccharides in a directional manner. Compared with the existing method of preparing alginate oligosaccharides by acid hydrolysis, it overcomes the disadvantage of large destructiveness. Compared with the existing method of enzymatic hydrolysis Compared with the method for preparing algin oligosaccharides, the modified recombinant algin lyase can reduce the amount of enzyme added, shorten the enzymatic hydrolysis time, and improve the enzymatic hydrolysis efficiency. The enzyme of the invention has high enzyme activity and high thermal stability, and is more suitable for industrial enzymatic hydrolysis of alginate to prepare alginate oligosaccharides. The prepared alginate oligosaccharide has the effects of anti-tumor, anti-inflammation, lowering blood fat, improving immunity, etc., can be used in the field of food and health care products, and has broad application prospects.

Description

technical field [0001] The invention belongs to the technical field of alginase, and in particular relates to an alginate lyase with better thermal stability and high enzyme activity. Background technique [0002] Alginate oligosaccharides (alginate oligosaccharides) are low molecular weight fragments obtained by hydrolyzing alginate with a small degree of polymerization and good water solubility. Because alginate oligosaccharide has various physiological activities such as hypolipidemic, antiviral, antitumor and antioxidative, it can be widely used in the fields of food, medicine and cosmetics, and has great application and development value. The latest research shows that the poly-M segment oligosaccharide drug "971" prepared from algin can inhibit the aggregation and cytotoxicity of β-amyloid cells, and is being used in the second phase clinical research of anti-Alzheimer's disease; poly-G oligosaccharide can Synergistically inhibits clinical multidrug-resistant pathogen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/88C12N15/60C12N15/70C12N1/21C12P19/00C12R1/19
CPCC12N9/88C12Y402/02011C12Y402/02003C12N15/70C12P19/00
Inventor 牟海津杨敏朱常亮
Owner OCEAN UNIV OF CHINA