Screening method of aptamer specifically combined with sarafloxacin hydrochloride

A technology of sarafloxacin hydrochloride and nucleic acid aptamer, which is applied in the field of chemical analysis and can solve problems such as antibiotic residues and food safety consequences

Active Publication Date: 2021-04-16
BEIJING UNIV OF CHEM TECH
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the toxicity of sarafloxacin, the extensive use of sarafloxacin in poultry and fish will lead to antibiotic residues, which will bring extremely serious consequences to people's food safety
Extensive use of sarafloxacin in poultry and fish will lead to antibiotic residues, which will bring extremely serious consequences to people's food safety

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Screening method of aptamer specifically combined with sarafloxacin hydrochloride
  • Screening method of aptamer specifically combined with sarafloxacin hydrochloride
  • Screening method of aptamer specifically combined with sarafloxacin hydrochloride

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0077]Example 1: SSDNA library and primers shown below:

[0078]Original random SSDNA library:

[0079]5'-aaggagcagcgtggaggata-n40-ttagggtgtgtcgtcgtggt-3 ';

[0080]Upstream primers: 5'-aaggagcagcgtggggaggata-3 '

[0081]Downstream primer 1: 5'-AccacgacgacaccccCTAA-3 '

[0082]Downstream primers 2: 5'-Bio-AccacgacgacaccccCTAA-3 '

Embodiment 2

[0083]Example 2: SELEX technology Screening specific nucleic acid fitting

[0084]2.1 Experimental solution required

[0085](1) 100ml screening fluid Selection Buffer configuration method: 0.037G KCL, 0.011G CaCL2, 0.5844G NaCl, 0.019G MGCL2, 0.24 g Tris, 20 μl Tween 20, pH to 7.6, with deionized water to 100 mL;

[0086](2) 100ml cleaning solution Washing Buffer configuration method: 21g urea, 0.48 g Tris, 0.37 g EDTA. NA220 μl Tween 20, adjustment pH to 8.0, with deionized water to 100 mL;

[0087](3) 100ml combined with eluate Binding and Washing (BW) Buffer configuration method: 0.12 g Tris, 0.037 g EDTA. NA211.68 g NaCl, pH to 7.4, with deionized water to 100ml;

[0088](4) 100ml amino bead coupling buffer configuration method: 1.95 g 2-morpholinacenesulfonic acid, pH to 4.0, with deionized water to 100 mL;

[0089](5) 100ml amino bead closed buffer configuration method: 2.4 g Tris, pH to 8.0, with deionized water to 100ml;

[0090](6) Binding buffer configuration of 100 ml streptavidin magnetic b...

Embodiment 3

[0124]Example 3. High-throughput sequencing and sequence analysis

[0125]The final round of screening products were subjected to agarose gel electrophoresis after PCR, and the 80 bp strip was subjected to a high-throughput sequencing. Send the number of times in high-throughput sequencing results to the company's synthesis, and then perform KD value detection, with software predict the secondary structure of the sequence. The sequencing results exclude the formation of primer dimers and the sequence containing the complementary chain of the upstream primer downstream primer 1. The two Kd minimal sequences with both target molecules are as follows:

[0126]F1: aaggagcagcgtggaggatctccgtgcgatccgggggggggccgaagaatcgtcacatcgttagggggTGTCGTCGTGGT

[0127]B1: aaggagcagcgtggaggatacccccccctagcatccataggcgaacctttctTGGGGGCTTAGGGTGTGTCGTCGTGTGGT

[0128]This sequence contains upstream primer AAGGAGCAGCGTGGAGGAGGATA, downstream primer 1 in reverse complementary chain sequence accacgacgacacccccCTAA.

[0129]The i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a screening method of an aptamer specifically combined with sarafloxacin hydrochloride, and relates to the technical field of chemical analysis. The nucleic acid aptamer capable of being used for sarafloxacin hydrochloride detection is higher in affinity specificity than a protein antibody, free of immunogenicity, capable of being chemically synthesized, small in molecular weight, stable in property and capable of being used for sarafloxacin hydrochloride detection. According to the invention, an SELEX technology is adopted, sarafloxacin hydrochloride is used as a target, and the aptamer specifically bound with sarafloxacin hydrochloride is screened out.

Description

Technical field[0001]The present invention relates to the field of chemical analysis, and in particular, a screening method of specific binding hydrochloride salad sofeng nucleic acid substrate.Background technique[0002]Nucleic acid adapter (also known as suitable ligand, Aptamer) is a synthetic SSDNA capable of screeing an index-enriched ligand system evolution (SELEX) technology. SSDNA that can be combined with target molecules or RNA fragment. The object has the advantages of a wide range of target molecules, strong affinity, and modification, and widely used in molecular chemistry, food safety, clinical diagnosis and treatment.[0003]SELEX is the principle of combined chemistry, and constructs an artificial synthetic random nucleotide library in vitro, and a new technique for screening a target nucleic acid body is screened by sequences in libraries. Since the random library contains a large number of single-stranded oligonucleotide fragments in a large number of primary structur...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/10C12N15/115
Inventor李灏丁于敬高子涵
OwnerBEIJING UNIV OF CHEM TECH