Method for in-vitro detection of miRNA based on ratio fluorescence of acridine orange and carbon dots

A ratiometric fluorescence and in vitro detection technology, applied in the field of miRNA in vitro detection, can solve the problems of complex components, background fluorescence interference system, quenching, etc., and achieve the effect of good repeatability and broad application prospects

Active Publication Date: 2021-05-14
SHANDONG UNIV
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, traditional fluorescence detection methods are vulnerable to background fluorescence interference and quenching effects of complex components in the system.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for in-vitro detection of miRNA based on ratio fluorescence of acridine orange and carbon dots
  • Method for in-vitro detection of miRNA based on ratio fluorescence of acridine orange and carbon dots
  • Method for in-vitro detection of miRNA based on ratio fluorescence of acridine orange and carbon dots

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Preparation method of carbon dots: Dissolve 1.8 g of citric acid in 30 mL of formamide and transfer it to a stainless steel reaction kettle lined with polytetrafluoroethylene, react at 180 ° C for 6 hours, wait for the reaction kettle to naturally cool to room temperature and then add it to the reaction solution. Add 120 mL of acetone and put it in the refrigerator, place it at -20 °C for 24 hours to generate carbon dot precipitation, centrifuge at 10,000 rpm for 20 minutes to separate the carbon dot precipitation, and add the carbon dot precipitation to 30 mL of methanol / acetone with 10% methanol volume. In the mixed solution, centrifuge and wash at 10,000 rpm for 20 minutes, repeat the centrifugation and washing for 3 times, and then re-dissolve the carbon dots in 10 mL of methanol, and filter them with a filter membrane with a pore size of 0.22 μm to remove large particles. Add 30 mL of acetone, wash by centrifugation at 10,000 rpm for 20 minutes, and dry at 50° C. fo...

Embodiment 2

[0048] Add 3 μL of miRNA solution to 292 μL of DNA probe solution with a concentration of 10 nM to make the final concentration of miRNA to be 8.5 nM. After incubating at 37°C for 90 minutes, add 3 μL of acridine orange solution with a concentration of 1.76 μM and adsorb for 10 minutes. Then add 2 μL of carbon dot solution with a concentration of 0.1 mg / mL and let it stand for 10 minutes. Test the fluorescence of the solution with a fluorescence spectrophotometer. Figure 5 The standard curve equation in the calculated miRNA concentration was 8.43 nM, which was close to the actual concentration of miRNA. The detection results show that the detection method has high accuracy.

Embodiment 3

[0050] 3 μL of three control miRNAs (sequences from 5' to 3', No.1 (hsa-miR-223-3p): UGUCAGUUUGUCAAAUACCCCA, No.2 (miR- 92a-3p-TMT): UUUUCCACUUGUCCCGGCCUGU, No.3 (miR-92a-3p-SMT): UAUUCCACUUGUCCCGGCCUGU) solution to make the final concentration of the control miRNA to be 7nM, after incubation at 37°C for 90 minutes, 3 μL of 1.76 μM was added to it. The acridine orange solution was adsorbed for 10 minutes, then 2 μL of carbon dot solution with a concentration of 0.1 mg / mL was added and left for 10 minutes, and the fluorescence of the solution was tested with a fluorescence spectrophotometer. Figure 5 The standard curve equations in the calculated concentrations of the three control miRNAs were -0.12, -0.19, and 0.01 nM, which were close to 0. The detection results show that the detection method has good specificity.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of biological detection and relates to a method for in-vitro detection of miRNA based on ratiometric fluorescence of acridine orange and carbon dots. The method comprises the following steps of preparing a carbon dot which is subjected to fluorescence resonance energy transfer with acridine orange, taking the acridine orange as a donor, taking the carbon dot as a receptor, and taking an antisense DNA chain of miRNA to be detected as a probe; adding a to-be-detected miRNA solution into a DNA probe solution with a certain concentration, incubating at 37 DEG C for 90 minutes, adding an acridine orange solution, adsorbing for 10 minutes, adding a carbon dot solution, and standing for 10 minutes; and testing fluorescence intensity of the mixed solution by using a fluorospectro photometer and calculating the concentration of the miRNA to be detected. The method is simple and convenient to operate, high in sensitivity and good in repeatability and specificity, and is a reliable method for miRNA in-vitro detection.

Description

technical field [0001] The invention belongs to the technical field of biological detection, and in particular relates to a method for in vitro detection of miRNA based on ratio fluorescence of acridine orange and carbon dots. Background technique [0002] The information disclosed in this Background section is only for enhancement of understanding of the general background of the invention and should not necessarily be taken as an acknowledgement or any form of suggestion that this information forms the prior art already known to a person of ordinary skill in the art. [0003] Cancer poses a serious threat to human health. Statistics show that the morbidity and mortality of colorectal cancer in the world ranks the third among various cancers, and it is increasing year by year. Studies have shown that cancer mortality can be reduced through early screening, diagnosis and treatment. The cure rate of early-stage colorectal cancer patients is high, and the 5-year survival rat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): G01N21/64
CPCG01N21/6402G01N21/6486
Inventor蒋妍彦杜鲁涛孙志伟童尧王凤龙岳寿伟
OwnerSHANDONG UNIV