A method based on ratiometric fluorescence of acridine orange and carbon dots for miRNA detection in vitro

A ratiometric fluorescence, in vitro detection technology, applied in the field of miRNA in vitro detection, can solve the problems of complex components, background fluorescence interference system, quenching, etc., and achieve the effect of good repeatability and broad application prospects.

Active Publication Date: 2022-03-18
SHANDONG UNIV
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, traditional fluorescence detection methods are vulnerable to background fluorescence interference and quenching effects of complex components in the system.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method based on ratiometric fluorescence of acridine orange and carbon dots for miRNA detection in vitro
  • A method based on ratiometric fluorescence of acridine orange and carbon dots for miRNA detection in vitro
  • A method based on ratiometric fluorescence of acridine orange and carbon dots for miRNA detection in vitro

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Preparation method of carbon dots: Dissolve 1.8g citric acid in 30mL formamide and transfer to a polytetrafluoroethylene-lined stainless steel reaction kettle, react at 180°C for 6 hours, and pour into the reaction solution after the reaction kettle is naturally cooled to room temperature Add 120mL of acetone and put it in the refrigerator, place it at -20°C for 24 hours to produce carbon dot precipitation, centrifuge at 10,000 rpm for 20 minutes to separate the carbon dot precipitation, add the carbon dot precipitation to 30mL methanol / acetone with 10% methanol volume In the mixed solution, wash by centrifugation at 10,000 rpm for 20 minutes, repeat the centrifugation and washing 3 times, redissolve the carbon dots in 10 mL of methanol, filter with a filter membrane with a pore size of 0.22 μm to remove large particles, and pour the carbon dots into the methanol solution. Add 30 mL of acetone, centrifuge and wash at 10,000 rpm for 20 minutes, and dry at 50°C for 12 hour...

Embodiment 2

[0048] Add 3 μL of miRNA solution to 292 μL of DNA probe solution with a concentration of 10 nM, so that the final concentration of miRNA is 8.5 nM, incubate at 37 ° C for 90 minutes, add 3 μL of acridine orange solution with a concentration of 1.76 μM and adsorb for 10 minutes, Then add 2 μL of carbon dot solution with a concentration of 0.1 mg / mL and let it stand for 10 minutes, and test the fluorescence of the solution with a fluorescence spectrophotometer, according to Figure 5 The standard curve equation in calculates the concentration of miRNA as 8.43nM, which is close to the actual concentration of miRNA. The test results show that the detection method has high accuracy.

Embodiment 3

[0050] Add 3 μL of three control miRNAs (sequence from 5' to 3', No.1(hsa-miR-223-3p): UGUCAGUUUGUCAAAUACCCCA, No.2(miR- 92a-3p-TMT): UUUUCCACUUGUCCCGGCCUGU, No.3 (miR-92a-3p-SMT): UAUUCCACUUGUCCCGGCCUGU) solution to make the final concentration of control miRNA 7nM, incubate at 37°C for 90 minutes and add 3 μL to it at a concentration of 1.76 μM acridine orange solution and adsorb for 10 minutes, then add 2 μL carbon dot solution with a concentration of 0.1 mg / mL and let it stand for 10 minutes, and test the fluorescence of the solution with a fluorescence spectrophotometer, according to Figure 5 The standard curve equation in calculates the concentrations of the three control miRNAs as -0.12, -0.19 and 0.01nM, which are close to 0. The detection results showed that the detection method had good specificity.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of biological detection, and relates to a method for in vitro detection of miRNA based on the ratio fluorescence of acridine orange and carbon dots. The method comprises the following steps: preparing carbon dots that undergo fluorescence resonance energy transfer with acridine orange, acridine orange as a donor and carbon dots as acceptors, using the antisense DNA strand of the miRNA to be tested as a probe; Add the solution to a certain concentration of DNA probe solution and incubate at 37°C for 90 minutes, add acridine orange solution and absorb for 10 minutes, add carbon dot solution and let it stand for 10 minutes; use a fluorescence spectrophotometer to test the fluorescence of the above mixed solution Intensity and calculate the concentration of miRNA to be tested. The invention has the advantages of simple operation, high sensitivity, good repeatability and specificity, and is a reliable method for in vitro detection of miRNA.

Description

technical field [0001] The invention belongs to the technical field of biological detection, and in particular relates to a method for in vitro detection of miRNA based on the ratio fluorescence of acridine orange and carbon dots. Background technique [0002] The information disclosed in this background section is only intended to increase the understanding of the general background of the present invention, and is not necessarily taken as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to those skilled in the art. [0003] Cancer poses a serious threat to human health. Statistics show that the morbidity and mortality of colorectal cancer rank third among all cancers in the world, and it is showing an increasing trend year by year. Research shows that cancer mortality can be reduced through early screening, diagnosis and treatment. The cure rate of patients with early colorectal cancer is high, and the 5-year surviv...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): G01N21/64
CPCG01N21/6402G01N21/6486
Inventor蒋妍彦杜鲁涛孙志伟童尧王凤龙岳寿伟
OwnerSHANDONG UNIV