Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant escherichia coli for producing isobutylamine as well as construction method and application of recombinant escherichia coli

A technology for recombining Escherichia coli and Escherichia coli, which is applied in the biological field and can solve the problems of limiting the wide application of isobutylamine, the high price of isobutylamine, and the inability to synthesize isobutylamine alone

Active Publication Date: 2021-05-28
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF8 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the raw material cost of producing isobutylamine is not high, because the synthesis process of producing isobutylamine by amination of isobutanol is a chain type cascade reaction at present, it is impossible to synthesize isobutylamine alone in theory, and there are diisobutylamine, three Isobutylamine by-product
Leading to the high price of isobutylamine
The price of industrial-grade isobutylamine is about 30,000 yuan / ton, and the high price limits the wide application of isobutylamine
[0004] At present, there is no industrial strain that can be used to produce isobutylamine internationally and domestically

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant escherichia coli for producing isobutylamine as well as construction method and application of recombinant escherichia coli
  • Recombinant escherichia coli for producing isobutylamine as well as construction method and application of recombinant escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0072] Embodiment 1, the selection of chassis bacteria

[0073] The performance of the chassis bacteria is very important. L-valine is the direct precursor of isobutylamine. It is necessary to construct a pathway for decarboxylation of L-valine to produce isobutylamine on a high-yield L-valine chassis bacteria. A high isobutylamine-producing strain.

[0074] Escherichia coli Sval031 is described in the patent application document with application number 202010466347.0. Escherichia coli Sval031 is a recombinant Escherichia coli that produces L-valine, with a yield of 82g / L and a transformation rate of 0.93mol 缬氨酸 / mol 葡萄糖 , almost no impurities, in line with industrial production requirements. In the present invention, Escherichia coli Sval031 is selected as the starting bacterium.

[0075] Escherichia coli (Escherichia coli) Sval031, has been preserved in the General Microbiology Center of the China Committee for Microbial Culture Collection (CGMCC for short) on March 6, 2...

Embodiment 2

[0076] Embodiment 2, the construction of recombinant escherichia coli ISO-001

[0077] 1. Amplification of VlmD insertion and constitutively expressed homologous recombination fragment

[0078] 1. Using the genomic DNA of the recombinant bacterium M1-93 as a template, PCR amplification was performed using a primer pair consisting of VlmD*kana frt up and VlmD*kana frtdown, and then the amplified product was recovered, and the obtained amplified product was named VlmD* 1. Amplification program: pre-denaturation at 98°C for 3 minutes; then denaturation at 98°C for 10 seconds, renaturation at 55°C for 30 seconds, extension at 72°C for 90 seconds, a total of 30 cycles; extension at 72°C for 10 minutes.

[0079] VlmD*kana frt up:

[0080] GTAACTCCGGGTTGATTTATGCTCGGAAATATTTGTTGTTGAGTTTTTTGTGTGTAGGCTGGAGCTGCTTC;

[0081] VlmD*kana frt down:

[0082] CTCGCGCTGCTGGTACTCATAGCTGTTTCCTGGTTTAAACGTAC.

[0083] In VlmD*1, the 1st-50th nucleotide is the upstream homology arm of one-step hom...

Embodiment 3

[0109] Embodiment 3, recombinant escherichia coli ISO-001 produces isobutylamine sulfate

[0110] 1. Preparation medium

[0111] Both the seed medium and the fermentation medium consisted of:

[0112] Macroelements: Glucose, (NH 4 ) 2 HPO 4 , NH 4 h 2 PO 4 , MgSO 4 ·7H 2 O;

[0113] Trace elements: FeCl 3 ·6H 2 O, CoCl 2 ·6H 2 O, CuCl 2 2H 2 O, ZnCl 2 、Na 2 MoO 4 2H 2 O, H 3 BO 3 and MnCl 2 4H 2 o 2 ;

[0114] water.

[0115] The same medium can be used for the seed medium and the fermentation medium.

[0116] The concentration of the above components in the culture medium can be respectively:

[0117] Macroelements: Glucose 50g / L-150g / L or 50g / L or 100g / L or 150g / L, NH 4 h 2 PO 4 0.5g / L-5g / L or 0.5g / L or 1g / L or 5g / L, (NH 4 ) 2 HPO 4 1g / L-10g / L or 1g / L or 3g / L or 10g / L, MgSO 4 ·7H 2 O 0.1g / L-5g / L or 0.1g / L or 1g / L or 5g / L;

[0118] Trace elements: FeCl 3 ·6H 2 O 0.2μg / L-5μg / or 0.2μg / L or 1.5μg / L or 5μg / L, CoCl 2 ·6H 2 O0.05μg / L-5μg / L ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombinant escherichia coli for producing isobutylamine as well as a construction method and an application of the recombinant escherichia coli. According to the present invention, the Escherichia coli Sval031 is adopted as the starting strain, the gene of the L-valine decarboxylase derived from Streptomyces viridifaeces is integrated to the starting strain, the expression intensity of the valine decarboxylase is improved by using the M1-93 promoter through the gene expression intensity regulation and control on the chromosome so as to obtain the isobutylamine high-yield strain ISO-001, the isobutylamine yield can achieve 52.7 g / L, and the conversion rate can reach 0.92 mol / mol. In order to further improve the production efficiency of the isobutylamine, the inventor of the invention optimizes the expression intensity of the VlmD gene by using an RBS library regulation technology, the strain ISO-I with higher production efficiency of the isobutylamine is obtained, and the yield of the isobutylamine is further improved by 66.4 g / L. The method realizes industrial fermentation production of isobutylamine, and has very strong industrial application potential.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a recombinant Escherichia coli producing isobutylamine and its construction method and application. Background technique [0002] Isobutylamine is a low-level aliphatic primary amine, which has the basic properties of a low-level aliphatic primary amine, and is widely used in medicine, pesticide, cosmetics, petroleum, electronics and other industries. First of all, isobutylamine has rich chemical properties. It can be dehydrogenated to synthesize isobutyronitrile under the catalysis of zinc sulfate and used as a key raw material for the pesticide diazinon; it can also be used to synthesize antiviral drugs amprenavir, darunavir, Sanavir, imiquimod; can also be used in the synthesis of antibacterial drugs moxifloxacin hydrochloride, rifabutin; gastric drug leminoprazole; can also be used in the synthesis of cosmetic functional ingredients octanoyl isobutylamine, cinnamoyl isobutylamine ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/70C12N9/88C12P13/00C12R1/19
CPCC12N9/88C12N15/70C12P13/001C12Y401/01014
Inventor 张学礼于勇徐洪涛刘萍萍唐金磊
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com