Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Colorectal cancer targeted therapy drug

A colorectal cancer and drug technology, applied in the field of tumor cell biology, can solve the complex problems of colorectal cancer, achieve excellent diagnostic value and inhibit proliferation

Active Publication Date: 2021-06-01
苏州瑞峰医药研发有限公司
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Although many studies have found that various factors play an important role in the pathogenesis of colorectal cancer, the occurrence and evolution of colorectal cancer is an intricate regulatory process, and there are still many problems that need further research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Colorectal cancer targeted therapy drug
  • Colorectal cancer targeted therapy drug
  • Colorectal cancer targeted therapy drug

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Detection of AC092635.1 Gene Expression Differences in Colorectal Tumor Tissues and Paracancerous Tissues

[0036] 1. Extraction of RNA from Tissues

[0037] (1) Put 50mg of colorectal cancer tissue and paracancerous tissue into a pre-cooled mortar, and quickly grind it into powder;

[0038] (2) Add 1ml Trizol to the mortar, mix thoroughly, transfer to an enzyme-free centrifuge tube, and let stand at room temperature for 5 minutes;

[0039] (3) Set the speed of the centrifuge to 12000rpm, put it into a centrifuge tube and centrifuge for 5min;

[0040] (4) Add 200 μl chloroform to the centrifuge tube, mix it upside down, and let it stand at room temperature for 10 minutes;

[0041] (5) Set the speed of the centrifuge to 12000rpm, put it into the centrifuge tube and centrifuge for 10min;

[0042] (6) The liquid is divided into three layers, transfer the supernatant of the upper layer to a new enzyme-free centrifuge tube, add an equal volume of pre-cooled isopropanol to...

Embodiment 2

[0072] Detection of the expression difference of AC092635.1 in colorectal cancer cells by fluorescent quantitative PCR

[0073] (1) Inoculate human normal colonic epithelial cells NCM460, HT29, SW620, SW480 and LOVO in the logarithmic growth phase in cell culture plates;

[0074] (2) After the cell density reaches 90%, add Trizol to extract RNA, RNA extraction, reverse transcription reaction and fluorescence quantitative PCR reaction steps are the same as in Example 1.

[0075] Differences in the expression of AC092635.1 in different colorectal cancer cells are as follows: Figure 5 shown. It can be seen that the expression level of AC092635.1 in colorectal cancer cells is significantly higher than that in normal human colonic epithelial cells NCM460, which is consistent with the expression level in tissues.

Embodiment 3

[0077] Design the interference RNA of AC092635.1 and verify the interference effect

[0078] (1) Design siRNA according to the sequence ENST00000434509.1 of the AC092635.1 gene, and the sequence of si AC092635.1 is as follows:

[0079] Justice strand: AAUUUUCCCCCUUUCUGUGGG, SEQ ID NO.6

[0080] Antisense strand: CACAGAAAGGGGGAAAAUUAG, SEQ ID NO.7;

[0081] (2) Inoculate SW480 cells in a 6-well plate. When the cells grow to 80%, transfect siNC and siAC092635.1 according to the instructions of LipoFiterTM 3.0. After 48 hours of transfection, extract RNA for fluorescent quantitative PCR detection. For specific steps, see Implementation example 1.

[0082] The knockdown effect of siAC092635.1 is as follows Figure 6 As shown, among them, the relative expression level of AC092635.1 in the siAC092635.1 group cells was (27.30±6.02)%. It can be seen that siAC092635.1 can effectively inhibit the expression of AC092635.1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a colorectal cancer targeted therapy drug, and belongs to the technical field of tumor cell biology. The invention provides a gene inhibitor of an AC092635.1 gene, and the gene inhibitor can be used for effectively inhibiting the expression of the AC092635.1 gene. Meanwhile, by means of a colony formation experiment, a Transwell chamber experiment and a Western Blot experiment, it is found that targeted inhibition of the AC092635.1 gene can effectively inhibit proliferation, migration, invasion and EMT transformation of colorectal cancer cells, and therefore the AC092635.1 gene can be used for preparing the medicine for treating the colorectal cancer.

Description

technical field [0001] The invention belongs to the technical field of tumor cell biology, and in particular relates to a drug for targeted therapy of colorectal cancer. Background technique [0002] Colorectal cancer is the most common malignant tumor in the digestive system, and colorectal cancer is characterized by high morbidity and high mortality. Currently, colorectal cancer has become the third most common malignant tumor in the world. The current main treatment methods for colorectal cancer are endoscopic resection, surgery, neoadjuvant chemotherapy, adjuvant chemotherapy, radiotherapy and targeted therapy. Although many new drugs have significant curative effects in the treatment of colorectal cancer, due to the The five-year survival rate of patients is still poor. Therefore, finding biomarkers closely related to the occurrence and development of colorectal cancer is crucial for monitoring tumor progression and finding therapeutic targets. [0003] Although many...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12N15/113A61K45/00A61K31/713A61P35/00A61P35/04
CPCA61P35/00A61P35/04A61K31/715Y02A50/30
Inventor 刘卡花姜顺顺刘玉敏
Owner 苏州瑞峰医药研发有限公司
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com