Colorectal cancer targeted therapy drug

A colorectal cancer and drug technology, applied in the field of tumor cell biology, can solve the complex problems of colorectal cancer, achieve excellent diagnostic value and inhibit proliferation

Active Publication Date: 2021-06-01

苏州瑞峰医药研发有限公司

4 Cites 0 Cited by

AI-Extracted Technical Summary

Problems solved by technology

[0003] Although many studies have found that various factors play an important role in the pathogenesis of colorectal cancer, the occurr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine

Abstract

The invention provides a colorectal cancer targeted therapy drug, and belongs to the technical field of tumor cell biology. The invention provides a gene inhibitor of an AC092635.1 gene, and the gene inhibitor can be used for effectively inhibiting the expression of the AC092635.1 gene. Meanwhile, by means of a colony formation experiment, a Transwell chamber experiment and a Western Blot experiment, it is found that targeted inhibition of the AC092635.1 gene can effectively inhibit proliferation, migration, invasion and EMT transformation of colorectal cancer cells, and therefore the AC092635.1 gene can be used for preparing the medicine for treating the colorectal cancer.

Application Domain

Organic active ingredientsMicrobiological testing/measurement +2

Technology Topic

Western blotTumor Cell Biology +12

Image

Examples

Experimental program(7)

Example Embodiment

[0034]Example 1

[0035]The expression difference between the AC092635.1 gene in colorectal tumor tissue and cancer tissue

[0036]1. Extract RNA in tissue

[0037](1) Put 50 mg of colorectal cancer tissue and cancer tissue into pre-cooling mortar, rapid grinding as powder;

[0038](2) 1 ml Trizol was added to the mortar, and then transferred until the enzyme centrifuge tube was sufficiently mixed, and the room temperature was allowed to stand for 5 min;

[0039](3) Set the centrifuge speed of 12000 rpm and centrifuge in the centrifuge tube.

[0040](4) 200 μl of chloroform was added to the centrifuge tube, and then configured at room temperature for 10 min.

[0041](5) Set the centrifuge speed of 12000 rpm and centrifuged in centrifuge tube for 10 min;

[0042](6) Liquid is divided into three layers, transferred to a new enzyme centrifugal tube in a new enzyme centrifuge tube, is mixed with an equal volume of pre-cooling isopropyl alcohol, placed on ice to stand for 10 min;

[0043](7) Set the centrifuge speed of 12000 rpm and add the centrifuge tube to centrifugal 10 min;

[0044](8) Abandon the supernatant, 1 ml of 1 mL was added to 75% ethanol placed by DEPC water, and then placed in a centrifuge, centrifuged for 10 min after mixing.

[0045](9) Remove the supernatant, dry RNA white precipitate in the ultra-clean counter, add 50 μl DEPC water to dissolve precipitation, and use a micro quantitative detector to detect the purity and concentration of RNA.

[0046]2. CDNA reverse transcription

[0047]Operation according to the TAKARA reverse transcription kit

[0048](1) Removing genomic DNA

[0049]Configure 10 μl of reaction system: 5 × gDNA eraser buffer 2.0μL, GDNA ERASER 1.0 μL, TotalRNA 1.0 μg, RNase Free DH2O Up to 10 μL.

[0050]The reaction conditions of the PCR instrument: 42 ° C for 2 minutes, 4 ° C.

[0051](2) Reverse transcription reaction

[0052]20 μl of the reaction system: 10 μl of the reaction liquid of step (1), Primescript RT Enzyme MIX I 1.0 μl, RT Primr Mix 1.0 μl, 5 × primescript buffer 2 4.0 μL, RNase Free DH2O 4.0 μL.

[0053]The reaction conditions of the PCR instrument: 37 ° C for 15 minutes, 85 ° C for 5 seconds, 4 ° C.

[0054]3. Fluorescence quantitative PCR reaction

[0055](1) Design primers for sequences (SEQ ID NO.1) in accordance with the AC092635.1 gene

[0056]The primer sequences of AC092635.1 are as follows:

[0057]Positive primer: 5'-acacactaaaactccccacagaa-3 '(SEQ ID NO.2)

[0058]Reverse primers: 5'-tacctgttgtgaccccgc-3 '(SEQ ID NO.3)

[0059]The primer sequence of GAPDH is as follows:

[0060]Positive primer: 5'-TTCacccatggagaagaaggc-3 '(SEQ ID No.4)

[0061]Reverse primers: 5'-ccacctggTGCTCAGTGTAG-3 '(SEQ ID NO.5)

[0062](2) Configure the reagent in accordance with Takara fluorescence quantitative PCR kit:

[0063]Configure the reagent: SYBR GREEN PREMIX EX TAQ (2 ×) 10 μL, a forward primer 0.4 μL, reverse primer 2. μl of CDNA template 2 μl, DDH2O 7.2 μl.

[0064]The parameters of the fluorescence quantitative PCR instrument are: 95 ° C 5 min; 95 ° C 15S, 60 ° C 40s 38 cycles

[0065](3) use GAPDH as a reference gene, 2△△ CTMethod calculates the relative expression of gene AC092635.1.

[0066]The experimental results are as follows:

[0067]The difference in expression of gene AC092635.1 in cancer tissue and colorectal cancer tissuesfigure 1. Among them, the relative expression volume of gene AC092635.1 in colorectal cancer tissue is (162.6 ± 55.32)%, it can be seen that the relative expression of gene AC092635.1 in colorectal cancer tissues is significantly higher than that of cancer, and differences has statistical significane.

[0068]At the same time, the present invention draws a ROC curve of gene AC092635.1 in colorectal cancer tissue and cancer, such asfigure 2 Indicated. Among them, the AUC value of the ROC curve is 0.8011, std.Error is 0.0559, 95% confidenceInterval is 0.6916 to 0.9107, P<0.0001 shows excellent diagnostic value, so it can be judged by detecting the expression of colorectal cancer tissue and the expression of gene AC092635.1 in cancer tissue.

[0069]In addition, the present invention statistics on the difference in expression of gene AC092635.1 in metamorphous tissue and non-metallic cancer tissue, and the resultsimage 3 Indicated. Among them, the relative expression volume of gene AC092635.1 in the transfer cancer tissue is (129.1 ± 10.54)%, which can be seen that the relative expression of gene AC092635.1 in metastatic cancer tissue is significantly higher than that Non-metastatic cancer tissues, and differences have statistically significant.

[0070]ROC curve of AC092635.1 in methacomic tissue and non-metastatic cancer tissueFigure 4 Indicated. Among them, the AUC value of the ROC curve is 0.9107, std.Error is 0.0514, 95% confidence interval is 0.8099to 1.011, P<0.001 shows excellent diagnostic value, so it can be judged by detecting the amount of expression of AC092635.1 to determine whether or not the colorectal cancer is transferred.

Example Embodiment

[0071]Example 2

[0072]Expression difference between AC092635.1 in colorectal cancer cells using fluorescent quantitative PCR

[0073](1) The normal colon epithelial cells of several long-term children were inoculated into the cell culture plate inoculated in the cell culture plate; and SW620, SW480 and LOVO;

[0074](2) Trizol extraction, reverse transcription reaction, and fluorescence quantitative PCR reaction step were added after the cell density reached 90%, and the RNA extraction, reverse transcription reaction and the fluorescence quantitative PCR reaction step were as in Example 1.

[0075]The difference in expression of AC092635.1 in different colorectal cancer cellsFigure 5 Indicated. It can be seen that the expression of AC092635.1 in colorectal cancer cells is significantly higher than that of human normal colon epithelial cell NCM460, which is consistent with the expression of expression in the tissue.

Example Embodiment

[0076]Example 3

[0077]Design AC092635.1 Interference RNA and verify the interference effect

[0078](1) Sequences of SiRNA, Si AC092635.1, based on the sequence of the AC092635.1 gene, as follows:

[0079]Justice chain: aauuuccccuuucugugggg, seq ID no.6

[0080]Antisense Chain: Cacagaaaggggguaaauuag, SEQ ID No.7;

[0081](2) SW480 cells were seeded in 6-well plates. When the cells were grown to 80%, SINC and SIAC092635.1 were transfected according to the LIPOFITERTM 3.0 specification, and after transfection 48h, extract RNA for fluorescence quantitative PCR detection, specific steps example 1.

[0082]SIAC092635.1 knock down effectFigure 6 As shown, the relative expression of AC092635.1 in SIAC092635.1 group is (27.30 ± 6.02)%, which can be seen that SIAC 092635.1 can effectively inhibit the expression of AC092635.1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine

Login to view more

PUM

Description & Claims & Application Information

We can also present the details of the Description, Claims and Application information to help users get a comprehensive understanding of the technical details of the patent, such as background art, summary of invention, brief description of drawings, description of embodiments, and other original content. On the other hand, users can also determine the specific scope of protection of the technology through the list of claims; as well as understand the changes in the life cycle of the technology with the presentation of the patent timeline. Login to view more.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine

Login to view more

Classification and recommendation of technical efficacy words

Inhibit proliferation
Excellent diagnostic value

Colorectal cancer targeted therapy drug

A colorectal cancer and drug technology, applied in the field of tumor cell biology, can solve the complex problems of colorectal cancer, achieve excellent diagnostic value and inhibit proliferation

AI-Extracted Technical Summary

Problems solved by technology

Abstract

Image

Examples

Example Embodiment

Example Embodiment

Example Embodiment

PUM

Description & Claims & Application Information

Similar technology patents

Application of acoustic hedgehog in preparation of aortic dissection auxiliary diagnostic reagent

Liver targeting cationic polymer as well as preparation method and application thereof

Novel Compositions and Methods of Treating Diseases Using the Same

Long non-coding RNA LINC02481 related to gastric cancer and application of long non-coding RNA LINC02481

Application of magnolol in preparation of antitumor drug

Classification and recommendation of technical efficacy words

Humanized anti-EGF receptor monoclonal antibody

Fusion molecules and IL-15 variants

Novel physiologically active substance

Single-stranded circular RNA and DNA and preparation method and application thereof

Apple peel powder, methods of making, and uses thereof

Long non-coding RNA LINC02481 related to gastric cancer and application of long non-coding RNA LINC02481

Application of acoustic hedgehog in preparation of aortic dissection auxiliary diagnostic reagent