Cotton high temperature response gene ghhrk1, encoded protein and application thereof
A cotton and high-temperature technology, applied in the fields of application, genetic engineering, and plant genetic improvement, can solve problems such as pollen abortion, male sterility, and key bud-bell shedding, and achieve the effect of enriching genetic resources
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Whole-genome and whole-transcriptome analysis of population transcriptome to obtain QTL loci significantly associated with pollen activity and candidate gene GhHRK1
[0051] SNP and InDel detection and annotation were carried out using the transcriptome sequencing data of 218 materials in the tetrad period, and high-quality variation sites were obtained. Genome-wide association analysis was performed to mine 3 QTLs related to pollen activity of upland cotton under high temperature. Each QTL contains 75 candidate genes. Using whole-transcriptome association analysis, the number of candidate genes was successfully narrowed down to 5, combined with QTL interval variation, gene expression in anthers at room temperature and high temperature, and referring to the function of Arabidopsis homologous genes, a candidate gene located on chromosome A01 was found Gene GhHRK1 (accession number Gh_A01G0682), encoding serine protein kinase, is the most significant difference in genotyp...
Embodiment 2
[0053] Abundance Analysis of GhHRK1 Transcripts in Extremely Sensitive High Temperature Materials
[0054] First, Xinluzao 35 (Xinluzao35, named "XJ13"), Xinluzhong 64 (Xinluzhong, named "XJ42"), Xinluzao 42 (Xinluzao 42, named "XJ17") in the population were tested. ) and extremely sensitive high temperature cotton materials Linnan 556 (Linnan 556, named "XJ208"), Beiersinuo (Beiersinuo, named "XJ124"), Soviet Union 8911 (Sulian 8911, named "XJ164") (extremely high temperature resistant Materials and extremely sensitive high-temperature cotton materials were donated by researcher Li Xueyuan of Xinjiang Academy of Agricultural Sciences in 2015) for pollen activity TTC (2,3,5-triphenyltetrazolium chloride) dyeing after high temperature stress. For specific dyeing methods, see The applicant previously applied for a patent (application number: 201910010240.2, a method and application for rapid quantification of pollen activity at room temperature or high temperature), and then too...
Embodiment 3
[0056] The GhHRK1 Arabidopsis homologous mutant hrk has enhanced high temperature tolerance
[0057] GhHRK1 is a negative regulator of cotton male reproductive organs in response to high temperature. In order to confirm that the HRK1 gene is conserved in response to high temperature in different species, the Arabidopsis homologous gene of GhHRK1 was obtained through homologous sequence alignment, and obtained from ABRC (Arabidopsis mutant germplasm resource bank) purchased the T-DNA insertion mutants hrk1-1 and hrk1-2 of the Arabidopsis HRK1 gene (SEQ ID NO:19) ( Figure 5 middle (a)). The insertion detection of mutant hrk1-1 and hrk1-2 was carried out by using two combined PCR methods of three primers. The primer sequence used for hrk1-1 insertion detection was forward primer HRK1-1LP: ACCTTGTCCAAGTTTGTTCCC (SEQ ID NO: 5) or T-DNA marker sequence primer: LB1.3: ATTTTGCCGATTTCGGAAC (SEQ ID NO: 7), reverse primer HRK1-1RP: TGTTGTCTTCAGGACTGGTCC (SEQ ID NO: 6); the primer seque...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


