Unlock instant, AI-driven research and patent intelligence for your innovation.

Cotton high temperature response gene ghhrk1, encoded protein and application thereof

A cotton and high-temperature technology, applied in the fields of application, genetic engineering, and plant genetic improvement, can solve problems such as pollen abortion, male sterility, and key bud-bell shedding, and achieve the effect of enriching genetic resources

Active Publication Date: 2022-04-01
HUAZHONG AGRI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, my country's cotton production areas have frequently encountered extreme high temperature weather exceeding 35°C from July to August in summer, resulting in a large number of key buds falling off in the concentrated boll-forming period. The main reason is that high temperature causes male sterility, such as: pollen abortion , Anthers do not dehisce, eventually leading to pollination failure, resulting in a decline in yield
But at present, there are few high-temperature-resistant genes and germplasms available for cotton, and the innovation of high-temperature-resistant germplasms once fell into a bottleneck

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cotton high temperature response gene ghhrk1, encoded protein and application thereof
  • Cotton high temperature response gene ghhrk1, encoded protein and application thereof
  • Cotton high temperature response gene ghhrk1, encoded protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Whole-genome and whole-transcriptome analysis of population transcriptome to obtain QTL loci significantly associated with pollen activity and candidate gene GhHRK1

[0051] SNP and InDel detection and annotation were carried out using the transcriptome sequencing data of 218 materials in the tetrad period, and high-quality variation sites were obtained. Genome-wide association analysis was performed to mine 3 QTLs related to pollen activity of upland cotton under high temperature. Each QTL contains 75 candidate genes. Using whole-transcriptome association analysis, the number of candidate genes was successfully narrowed down to 5, combined with QTL interval variation, gene expression in anthers at room temperature and high temperature, and referring to the function of Arabidopsis homologous genes, a candidate gene located on chromosome A01 was found Gene GhHRK1 (accession number Gh_A01G0682), encoding serine protein kinase, is the most significant difference in genotyp...

Embodiment 2

[0053] Abundance Analysis of GhHRK1 Transcripts in Extremely Sensitive High Temperature Materials

[0054] First, Xinluzao 35 (Xinluzao35, named "XJ13"), Xinluzhong 64 (Xinluzhong, named "XJ42"), Xinluzao 42 (Xinluzao 42, named "XJ17") in the population were tested. ) and extremely sensitive high temperature cotton materials Linnan 556 (Linnan 556, named "XJ208"), Beiersinuo (Beiersinuo, named "XJ124"), Soviet Union 8911 (Sulian 8911, named "XJ164") (extremely high temperature resistant Materials and extremely sensitive high-temperature cotton materials were donated by researcher Li Xueyuan of Xinjiang Academy of Agricultural Sciences in 2015) for pollen activity TTC (2,3,5-triphenyltetrazolium chloride) dyeing after high temperature stress. For specific dyeing methods, see The applicant previously applied for a patent (application number: 201910010240.2, a method and application for rapid quantification of pollen activity at room temperature or high temperature), and then too...

Embodiment 3

[0056] The GhHRK1 Arabidopsis homologous mutant hrk has enhanced high temperature tolerance

[0057] GhHRK1 is a negative regulator of cotton male reproductive organs in response to high temperature. In order to confirm that the HRK1 gene is conserved in response to high temperature in different species, the Arabidopsis homologous gene of GhHRK1 was obtained through homologous sequence alignment, and obtained from ABRC (Arabidopsis mutant germplasm resource bank) purchased the T-DNA insertion mutants hrk1-1 and hrk1-2 of the Arabidopsis HRK1 gene (SEQ ID NO:19) ( Figure 5 middle (a)). The insertion detection of mutant hrk1-1 and hrk1-2 was carried out by using two combined PCR methods of three primers. The primer sequence used for hrk1-1 insertion detection was forward primer HRK1-1LP: ACCTTGTCCAAGTTTGTTCCC (SEQ ID NO: 5) or T-DNA marker sequence primer: LB1.3: ATTTTGCCGATTTCGGAAC (SEQ ID NO: 7), reverse primer HRK1-1RP: TGTTGTCTTCAGGACTGGTCC (SEQ ID NO: 6); the primer seque...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a cotton high temperature response gene GhHRK1, an encoded protein and applications thereof, belonging to the technical field of plant breeding. The invention uses the anther transcriptome data of the natural population of cotton to carry out the correlation analysis of the whole genome and the whole transcriptome, and discovers the key gene GhHRK1 of cotton responding to high temperature. Through transcriptome data analysis and in situ hybridization experiments, it was found that the transcript abundance of GhHRK1 in extremely high temperature materials was significantly higher than that in high temperature materials. The high temperature resistance of Arabidopsis HRK1 homologous mutant hrk1 was also increased, and its high temperature resistance could be complemented by GhHRK1. The invention provides a method for creating high temperature resistant cotton germplasm by using GhHRK1 gene, which is of great significance for guiding the improvement of high temperature resistant cotton germplasm.

Description

technical field [0001] The invention belongs to the technical field of plant breeding, and in particular relates to a cotton high temperature response gene GhHRK1, encoded protein and application thereof. Background technique [0002] Cotton (Gossypium hirsutum Linn) is the seed fiber of Malvaceae and Gossypium plants. It is an important economic crop. Its optimum growth temperature is 20-30°C. Exceeding the optimum growth temperature will lead to Cotton pollen activity is reduced, the boll setting rate is reduced, and fiber development is hindered, which seriously affects cotton fiber yield and quality (Pettigrew 2008). In recent years, my country's cotton production areas have frequently encountered extreme high temperature weather exceeding 35°C from July to August in summer, resulting in a large number of key buds falling off in the concentrated boll-forming period. The main reason is that high temperature causes male sterility, such as: pollen abortion , Anthers do not ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00A01H6/20A01H6/60
CPCC07K14/415C12N15/8289
Inventor 闵玲马益赞张献龙
Owner HUAZHONG AGRI UNIV