Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of linc00167 in the preparation of drugs for inhibiting tumor angiogenesis

An angiogenesis and drug technology, applied in the field of biomedicine, can solve the problems of tumor angiogenesis and negative impact on the prognosis of radiotherapy patients, so as to reduce the probability of recurrence and improve the prognosis

Active Publication Date: 2022-03-29
SUZHOU UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, during conventional photon radiotherapy (XRT), tumor angiogenesis is exacerbated after radiotherapy, which promotes distant metastasis and recurrence of tumors, which has a negative impact on the prognosis of radiotherapy patients.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of linc00167 in the preparation of drugs for inhibiting tumor angiogenesis
  • Application of linc00167 in the preparation of drugs for inhibiting tumor angiogenesis
  • Application of linc00167 in the preparation of drugs for inhibiting tumor angiogenesis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] (1) The present invention passes a bio-experimental technique, screened a long-chain non-coding RNA: LINC00167, which is up-regulated after irradiation, has a nucleotide sequence as follows:

[0030]attttgggtgggactaagcaaagacgaaacaccctcccagtctatggggtagtctggaccctggcttatctggttcccttaatcctttaggtacttacacgacgttgggtgaggggagctggaagatcagcgggtccccgatcctctctccctaggggtgatagaaatcaaccccccccgccacctccaggtggttcttcccgccgcagagtgggagcagcataaaaggcggggtcttattagcataatctgcctggcaacctgatctcgacgttatatgattggttaaactctgtaagccccatgccgtgcctagagacgagaaacgctggggcgaactgacaggcccagatttaggagtcatgacgaagatcctgagacgcttattcagtctgcagagaagccaaaaggagattcacataatggcccaatgactgaaggcctctttatttcgtgctctgctgttcgtgtaaaacccaatcgcagagcgggtctcaggcggcgctcgcctgcgtttctactctcagccaatcagaaaacccgactcttcgcattggggtcaagcccccgctgcggcccgcgtgctaacggggaggaagcttccagctgtgcctgggtgtctcgggcgccgagggcagcctgcgcccgtgctaagcccgcctcccgcgcgcccgagggcccggtgtcccggaagacgcgcgggggtgaggcggccctcgcgtccgcccgccccgccacagattgcctccgaagtggcctggccgtggagcgccggcgaaaaccgaactc...

Embodiment 2

[0034] Example 2 Impact of Irradiation on LINC00167 Expression

[0035] (1) Cell culture

[0036] The stable lung cancer cell line A549 cells were selected, cultured with RPMI-1640, placed at 37 ° C constant temperature, 5% CO 2 Culture in the cell incubator; first in sterile PBS in a sterile PBS in a sterile PBS, then use 0.25% trypsin to digest 1-2 min, and after the cells are digestion from the culture dish, 10% fetal bovine serum is used. The RPMI-1640 complete medium retained; in a new dish, the RPMI-1640 fully medium solution was added to expand the culture.

[0037] (2) Irradiation treatment

[0038] The cultured A549 cells was divided into control group and experimental group, with about 1 × 10 per group. 8 A cells; electrical energy excitation X-ray irradiation instrument (Model RAD · SOURCE, RS-2000) using biological experiments, the voltage is 50kV, the dose rate is 1.224Gy / min, the experimental group accepts 2GY X-rays Ignor, the control group was not irradiated; the...

Embodiment 3

[0049] Example 3 Vascular formation experiment

[0050] The A549 cell culture was cultured in a 6-well plate, which was brought to 60% -70%, and X-ray irradiation was performed. The dose was 2 Gy, and after irradiation at 37 ° C, 5% CO 2 Take 24 h under conditions, the medium of A549 cell culture medium, cultured HUVEC cells, observed the conditions of the conditions of the irradiation group and the non-irradiated group on the level of HUVEC cytotropic formation.

[0051] The day before the experiment, MATRIGEL (Corning 354234-9148009) was placed in 4 ° C melting. Sterilization 200 μL gun, 1ml gun head, and 96-well plate refrigeration. When the experiment is started, MATRIGEL has been placed on ice or ice box, ensuring that the Matrigel concentration is greater than or equal to 10 mg / ml, evenly ground in a pre-cooling 96-well plate, 100 μL per well. The entire petri dish was placed in an incubator and put it 30 min to solidify the glue. In the process of waiting for the glue, ta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of LINC00167 in the preparation of drugs for inhibiting tumor angiogenesis, and belongs to the technical field of biomedicine. LINC00167 is an lncRNA closely related to ionizing radiation stimulation. After X-ray irradiation, its expression level increased significantly, and with the extension of time after irradiation, the expression level became higher and higher. At the same time, the expression level of LINC00167 is positively correlated with the level of tumor angiogenesis, which means that it may play a key role in the response of tumors to radiation stimulation; this can be used to artificially inhibit the high expression of LINC00167 after irradiation, In this way, it can achieve the same effect as the commonly used clinical vascular inhibitors, improve the prognosis of tumor patients after radiotherapy, and reduce the chance of tumor recurrence.

Description

Technical field [0001] The present invention relates to the field of biomedical technology, and more particularly to the use of LINC00167 in the preparation of inhibiting tumor angiogenesis. Background technique [0002] Long chain non-encoded RNA (LONG NO-Coding RNA, LNCRNA) is an RNA fragment that does not have protein encoding function, which is generally greater than 200 nucleotides, and is widely present in the human genome, and accounts for total genome of human. 98%, that is, only about 2% of the RNA has protein coding function; so lncrna once considered "garbage gene" by scientists. In recent years, as the research continues to deepest, scientists have found that LNCRNA can not encode proteins, but can function with DNA or RNA, even combined with protein, constitute a fine and complex biological regulation network. At present, biological research has shown that LNCRNA involved in procedural cell apoptosis, apparent genetics, metastasis of cancer cells, and biological proc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K31/7088A61P35/00
CPCA61K31/7088A61P35/00
Inventor 周光明黄皓胡文涛
Owner SUZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com