Unlock instant, AI-driven research and patent intelligence for your innovation.

A kit for detecting Drosophila spotted wing based on terrestrial environment DNA and its application

A spotted-winged Drosophila and a kit technology, applied in the field of agricultural biology, can solve the problems that the identification and monitoring are difficult to eliminate the influence of interfering factors, the technicians cannot make very objective judgments, the detection object is single, etc., and the detection efficiency and timeliness are achieved. The effect of good performance and simple detection process

Active Publication Date: 2022-03-01
HUNAN UNIV OF SCI & TECH
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0013] Most of the existing terrestrial agricultural pest detection technologies need to judge the insect body itself, and it is difficult to rule out the influence of many external interference factors in the identification and monitoring process, so that technicians cannot make very objective judgments
And a single detection object is single, time-sensitive, time-consuming and labor-intensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kit for detecting Drosophila spotted wing based on terrestrial environment DNA and its application
  • A kit for detecting Drosophila spotted wing based on terrestrial environment DNA and its application
  • A kit for detecting Drosophila spotted wing based on terrestrial environment DNA and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044]A kit for detecting terrestrial Drosophila spotted wing based on environmental DNA, including primer pairs and Taqman fluorescent probes designed according to the gene of the target pest Drosophila spotted wing;

[0045] The selected Drosophila spotted wing specific DNA sequence is shown in SEQ ID NO.1, which is derived from the difference sequence between the Drosophila spotted wing genome and the genome of similar species, and the specific sequence is:

[0046] GGAAAGTCGTCGCCAAAGTTGCCGTCACATGTTGCACTTCTCCAGCCCGCCATAATTGCTCCTAATTGAAATGCGAAACCCGCAACAAAACTGAACCGAAATGCCAGC

[0047] Primer pairs included BCGY4-F and BCGY4-R.

[0048] The DNA sequence of BCGY4-F is shown in SEQ ID NO.2, specifically: GGAAAGTCGTCGCCAAAGTT.

[0049] The DNA sequence of BCGY4-R is shown in SEQ ID NO.3; specifically: GCTGGCATTTCGGTTCAGTT.

[0050] The DNA sequence of the Taqman fluorescent probe is shown in SEQ ID NO.4, specifically: CACATGTTGCACTTCTCAGCCCGCCATAA.

Embodiment 2

[0052] A method for detecting Drosophila spotted wing content in the terrestrial environment of the kit of embodiment 1, specifically:

[0053] (1) Establish a standard curve for Drosophila spotted wing:

[0054] 1.1. Use the TSINGKE Animal Genomic DNA Kit to extract 50 μL of the genomic DNA of Drosophila spotted wing adults two days after eclosion, and measure its concentration by an ultraviolet spectrophotometer to be 156.0 ng / μL.

[0055] 1.2. Using deionized water, the genomic DNA of Drosophila spotted wing was diluted to 10 times according to a 10-fold gradient. -1 、10 -2 、10 -3 、10 -4 times liquid. The stock solution and the above dilution were used as standard sample templates for Real-time qPCR reactions, and two sets of biological replicates were performed.

[0056] Table 1 qPCR reaction system

[0057]

[0058] Table 2 qPCR reaction program

[0059]

[0060] 1.3. Two standard curves with close Cq values ​​in each standard sample group were obtained in tw...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a kit product suitable for quantitative detection of spotted wing Drosophila pest damage based on terrestrial environment DNA. The kit includes Drosophila spotted wing upstream primer (BCGY4‑F), Drosophila spotted wing downstream primer (BCGY4‑R), Taqman fluorescent probe and qPCR Mix four reagents. This kit can be used in conjunction with other commercially available products, such as Carmel peristaltic pumps, Millipore polycarbonate erosion membranes, qPCR8-connected tubes, etc., to quantify the results on fruits and vegetables that have been mixed with Drosophila spotted wing for a period of time. The amount of DNA left by Drosophila spotted wing was detected. Steps for use: 1. Take fruits and vegetables and rinse; 2. Etch the filter membrane to filter the rinse solution; 3. Cut the filter membrane to collect eDNA; 4. Use eDNA as a template to perform qPCR reaction. This product can be used in the qualitative detection of pests in orchards, with high specificity and good timeliness; it can also quantitatively detect the density of pests in the environment, which is conducive to reflecting the seriousness of pest damage and predicting the occurrence of pest damage in the next year. At the same time, this product also has potential value in customs detection of invasive alien species and ecological population analysis.

Description

technical field [0001] The invention relates to the field of agricultural biotechnology, in particular to a kit for detecting Drosophila spottedwings based on terrestrial environment DNA and an application thereof. Background technique [0002] Spotted Drosophila ( Drosophila suzukii ), also known as Drosophila suzuki, is an important agricultural pest in the Drosophila family. The ovipositor of the female is hard and serrated, and can lay eggs directly in ripe or soon-to-mature grapes, strawberries, blueberries, tomatoes, cherries and other fruits and vegetables. The area around the food point quickly begins to rot, and causes secondary infection of fungi and bacteria, which accelerates the rot of the fruit. Once an insect infestation occurs, it will cause serious losses to the orchard. Qualitative detection of the presence or absence of Drosophila spotted wing and quantitative detection of the density of Drosophila spotted wing will have important indication significanc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12Q1/6851
CPCC12Q1/6888C12Q1/6851C12Q2531/113C12Q2561/101C12Q2545/114Y02A90/40
Inventor 莫晶张翼飞刘雨芳欧雪儿许铭元黄汇
Owner HUNAN UNIV OF SCI & TECH