Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of universal DNA vaccine of type A influenza virus and its construction method

A type of influenza A virus and DNA vaccine technology, applied in the field of genetic engineering, can solve problems such as limiting the applicability and effectiveness of vaccines, failing to protect patients, and new mutants of influenza A virus, achieving important scientific significance and social value. , the effect of high protective efficacy

Active Publication Date: 2022-06-07
QINGDAO AGRI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The most effective way to prevent and control influenza A is vaccination. Most influenza A vaccines currently available are subtype-specific, and influenza A viruses are prone to mutations and new variants, and cannot protect patients from immunity. Influenced by other virus subtypes, which greatly limits the applicability and effectiveness of the vaccine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of universal DNA vaccine of type A influenza virus and its construction method
  • A kind of universal DNA vaccine of type A influenza virus and its construction method
  • A kind of universal DNA vaccine of type A influenza virus and its construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Construction of plasmid pVAX1-4M2e

[0035] According to the nucleotide sequences of M2e of 4 subtypes of influenza A virus, the target gene 4M2e sequence of universal DNA vaccine was designed by a combinatorial strategy.

[0036] First, the genes of H9 subtype, H1 subtype, H3 subtype and H5 subtype were combined in series to form a gene construct, and after codon optimization, the designed gene construct was combined with tissue plasminogen activator (tPA) secretion sequence (nucleotide sequence shown in SEQ ID NO: 2) is combined to further improve the secretion of the target protein (such as figure 1 ).

[0037] Use PCR technology to amplify the target fragment 4M2e, and the amplification primers are:

[0038] Upstream primer sequence: AATCGAATTCATGGATGCAATGAAGAGAGG

[0039] Downstream primer sequence: AATCCTCGAGTCAATCAGAGGAGTAGTGTCACTAC

[0040] The target gene 4M2ePCR amplification system is shown in Table 1:

[0041] Table 1

[0042]

[0043] The...

Embodiment 2

[0050] Example 2 Gel retardation experiment

[0051] The experiments were divided into the following three groups:

[0052] Experiment group: The cell-penetrating peptide RVG(9dR) (Shanghai Sangon Bioengineering Co., Ltd.) with a storage concentration of 1 mg / mL was taken out from -20°C and placed on an ice box to thaw naturally. Take 1 μg of pVax1-4M2e eukaryotic expression plasmid, prepare a mixed solution with RVG (9dR) according to the ratio of 1:0.5, 1:1, 1:2, 1:4, 1:8, and gently pipette with a pipette. Mix well and let stand for 20min at room temperature to fully combine.

[0053] Experiment group 2: The cell-penetrating peptide Protamine (Shanghai Sangon Bioengineering Co., Ltd.) with a storage concentration of 1 mg / mL was taken out from -20°C and placed on an ice box to thaw naturally, and then extracted from a large amount of pVax1-4M2e Take 1 μg of the eukaryotic expression plasmid, prepare a mixed solution with Protamine according to the ratio of 1:0.5, 1:1, 1:2,...

Embodiment 3

[0056] Example 3 Cell transfection experiment

[0057] Cell culture: 293T cells were cultured in DMEM medium containing 10% fetal bovine serum (Fetal Bovine Serum, FBS) and 1% double antibody (Penicillin-Streptomycin Solution, PS) in a 37°C incubator. (Medium and serum were purchased from Biological Industries).

[0058] Transfection: 293T cells were plated in 6-well cell culture plates, 1 × 10 per well 6 After the cells were grown into a uniform monolayer, the subsequent transfection experiments were carried out the next day.

[0059] Plasmid DNA (pVAX1-EGFP) was used as a model to conduct cell transfection experiments, and the effect of three cell-penetrating peptides on plasmid DNA delivery at the cellular level was judged from cell fluorescence and fluorescence intensity. Specific steps are as follows:

[0060] (1) Discard the original cell culture medium in each well of the 6-well plate, and wash with phosphate buffered saline PBS for 1-2 times.

[0061] (2) Add 2 mL ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a universal DNA vaccine of type A influenza virus and a construction method thereof, belonging to the technical field of genetic engineering. The DNA vaccine includes a gene construct, a carrier and a delivery system, the gene construct is inserted into the vector to construct an expression plasmid, and the delivery system is coated with the expression plasmid to form a universal DNA vaccine for influenza A virus, wherein the The gene construct is formed by serially combining the conserved sequence M2e genes of four different subtypes of influenza A viruses, and the delivery system is a cell-penetrating peptide. The vaccine combines the advantages of the extracellular region of influenza A virus M2 protein, universal vaccine and DNA vaccine, can effectively prevent and control different subtypes of influenza A virus, and has important scientific significance and social value.

Description

technical field [0001] The invention relates to the field of genetic engineering, and relates to a universal DNA vaccine for influenza A virus and a construction method thereof. Background technique [0002] Influenza is a severe acute respiratory infection caused by influenza virus infection. It causes a large number of deaths of humans and animals around the world every year, and brings a serious threat to global public health and economic development. According to the characteristics of viral nucleocapsid protein (NP) and matrix protein M, influenza virus can be divided into three subtypes: A, B, and C. Among them, influenza A virus (Influenza A virus) is currently the most widespread and influential. The most far-reaching flu virus. Influenza A virus often undergoes unpredictable mutations due to its genetic characteristics. Therefore, the research and prevention of influenza A virus cannot be ignored. [0003] The most effective way to prevent and control influenza A...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K39/145A61K47/64A61K48/00A61P31/16C12N15/62C12N15/44C12N15/79
CPCA61K39/12A61K47/64A61K48/0025A61K48/005A61P31/16C07K14/005C12N15/79C12N2760/16134A61K2039/53
Inventor 李军伟赵美霞刘凯旋马清霞
Owner QINGDAO AGRI UNIV