A kind of universal DNA vaccine of type A influenza virus and its construction method
A type of influenza A virus and DNA vaccine technology, applied in the field of genetic engineering, can solve problems such as limiting the applicability and effectiveness of vaccines, failing to protect patients, and new mutants of influenza A virus, achieving important scientific significance and social value. , the effect of high protective efficacy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1 Construction of plasmid pVAX1-4M2e
[0035] According to the nucleotide sequences of M2e of 4 subtypes of influenza A virus, the target gene 4M2e sequence of universal DNA vaccine was designed by a combinatorial strategy.
[0036] First, the genes of H9 subtype, H1 subtype, H3 subtype and H5 subtype were combined in series to form a gene construct, and after codon optimization, the designed gene construct was combined with tissue plasminogen activator (tPA) secretion sequence (nucleotide sequence shown in SEQ ID NO: 2) is combined to further improve the secretion of the target protein (such as figure 1 ).
[0037] Use PCR technology to amplify the target fragment 4M2e, and the amplification primers are:
[0038] Upstream primer sequence: AATCGAATTCATGGATGCAATGAAGAGAGG
[0039] Downstream primer sequence: AATCCTCGAGTCAATCAGAGGAGTAGTGTCACTAC
[0040] The target gene 4M2ePCR amplification system is shown in Table 1:
[0041] Table 1
[0042]
[0043] The...
Embodiment 2
[0050] Example 2 Gel retardation experiment
[0051] The experiments were divided into the following three groups:
[0052] Experiment group: The cell-penetrating peptide RVG(9dR) (Shanghai Sangon Bioengineering Co., Ltd.) with a storage concentration of 1 mg / mL was taken out from -20°C and placed on an ice box to thaw naturally. Take 1 μg of pVax1-4M2e eukaryotic expression plasmid, prepare a mixed solution with RVG (9dR) according to the ratio of 1:0.5, 1:1, 1:2, 1:4, 1:8, and gently pipette with a pipette. Mix well and let stand for 20min at room temperature to fully combine.
[0053] Experiment group 2: The cell-penetrating peptide Protamine (Shanghai Sangon Bioengineering Co., Ltd.) with a storage concentration of 1 mg / mL was taken out from -20°C and placed on an ice box to thaw naturally, and then extracted from a large amount of pVax1-4M2e Take 1 μg of the eukaryotic expression plasmid, prepare a mixed solution with Protamine according to the ratio of 1:0.5, 1:1, 1:2,...
Embodiment 3
[0056] Example 3 Cell transfection experiment
[0057] Cell culture: 293T cells were cultured in DMEM medium containing 10% fetal bovine serum (Fetal Bovine Serum, FBS) and 1% double antibody (Penicillin-Streptomycin Solution, PS) in a 37°C incubator. (Medium and serum were purchased from Biological Industries).
[0058] Transfection: 293T cells were plated in 6-well cell culture plates, 1 × 10 per well 6 After the cells were grown into a uniform monolayer, the subsequent transfection experiments were carried out the next day.
[0059] Plasmid DNA (pVAX1-EGFP) was used as a model to conduct cell transfection experiments, and the effect of three cell-penetrating peptides on plasmid DNA delivery at the cellular level was judged from cell fluorescence and fluorescence intensity. Specific steps are as follows:
[0060] (1) Discard the original cell culture medium in each well of the 6-well plate, and wash with phosphate buffered saline PBS for 1-2 times.
[0061] (2) Add 2 mL ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com