Supercharge Your Innovation With Domain-Expert AI Agents!

Agrobacterium binary expression vector

A binary expression vector, Agrobacterium technology, applied in the direction of introducing foreign genetic material, bacteria, biochemical equipment and methods using vectors, etc., can solve the inability to monitor the expression of the target protein in situ and real-time, and the inability to realize the expression of the target protein. Visualization etc.

Active Publication Date: 2021-08-24
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, both types of vectors have certain defects: after the pEAQ series vectors infect tobacco, the expression of the target gene can only be determined by qRT-PCR or western-blot detection after sampling, and the expression of the target protein cannot be determined. Visualization: The GUS screening marker is introduced into the pCambia2301 vector, and the expression of the protein can be detected visually by GUS staining, but this detection requires the sample to be removed and stained, and it is impossible to monitor the expression of the target protein in situ and in real time
However, traditional GFP needs to use a laser confocal microscope or under a specific filter to observe the generation of fluorescence

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Agrobacterium binary expression vector
  • Agrobacterium binary expression vector
  • Agrobacterium binary expression vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Deletion of the GUS screening marker in the original vector pCambia2301 of embodiment 1

[0044] 1.1 Utilize recombinase Redα / β or RecE / T-mediated homologous recombination to precisely modify DNA molecules to delete GUS screening markers and their promoters and terminators. The steps include: adding the original pCambia2301 vector (Invitrogen Corporation ) was digested at 37° C. with restriction endonucleases SnaBI and MaubI (Thermofisher Company) to obtain a linearized pCambia2301 vector.

[0045] 1.2 Then, the above-mentioned linearized pCambia2301 vector and primers GUS-deletion-F and GUS-deletion-R were recombined in DH10β Escherichia coli (NEB Company) in vivo using Red / ET technology. Recombinant Escherichia coli DH10β was cultured overnight at 37°C in LB medium containing kanamycin sulfate.

[0046] The primer sequences (5'-3') used are:

[0047] GUS-deletion-F:

[0048] CTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATC;

[0049]...

Embodiment 2

[0052] Embodiment 2 optimizes the construction of carrier

[0053] 2.1 Synthesis of the insert fragment (Insert fragment): The insert fragment contains seven parts: 35S promoter, 5'UTR, P19, F2A peptide, eyGFPuv, 3'UTR and NosT, and the structure is 35S promoter-5'UTR-P19- 2A peptide-eyGFPuv-3'UTR-NosT, the nucleotide sequence of the fusion gene is SEQ ID NO:1.

[0054] The fusion sequence was synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0055] 2.2 Construction of an optimized vector: Digest the insert fragment synthesized in step 2.1 and the intermediate vector pCambia2301-Gus-Del vector obtained in Example 1 with restriction enzymes ECoRI and SmaI (NEB Company) at 37°C for 12h to obtain Linearized pCambia2301-Gus-Del vector. Then, T4 DNA Ligase (NEB Company) was used to perform ligation according to the instructions of the kit to construct an optimized vector pCambia2301-Optimized, named pF08, which was verified to be correct by sequencing. The nucleotide se...

Embodiment 3

[0056] Example 3 Amplification of Amoline Biosynthesis-Related Genes

[0057] Referring to the method disclosed in the patent document CN202010092362.3, the target genes TDC, SLS1, STR, NPF2.9, SGD and HYS related to amoline biosynthesis were amplified. Including the following steps.

[0058] 3.1 Extraction of periwinkle total RNA and reverse transcription

[0059] The periwinkle leaves were ground into powder with liquid nitrogen, and 100 mg of the ground powder was placed in a centrifuge tube with 1.5 mL of RNA free, and then RNA was extracted according to the instructions of Quanjin’s RNA extraction kit. The extracted RNA is directly reverse-transcribed to produce cDNA.

[0060] Take 1 μg of RNA and reverse transcribe to produce cDNA using Quanshijin reverse transcription kit.

[0061] 3.2 Target gene cloning

[0062] Use the periwinkle cDNA obtained by reverse transcription in step 3.1 as a template, and use the primers shown in Table 1 to amplify according to the foll...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an agrobacterium binary expression vector, and the expression vector comprises a vector pCambia2301 skeleton without a GUS (glucuronidase) selection marker gene, a 35S promoter gene, a P19 protein coding gene and a GFP (green fluorescent protein) selection marker gene; the optimized agrobacterium binary expression vector not only can improve the expression quantity of heterologous genes, but also can monitor the expression condition of heterologous proteins in real time and in situ. Target genes TDC, SLS, STR, NPF2.9, SGD and HYS related to biosynthesis of the amorph can be cloned into the Agrobacterium tumefaciens binary expression vector, heterologous biosynthesis of the amorph in tobacco is promoted, and the Agrobacterium tumefaciens binary expression vector has application prospects.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and biosynthesis, and in particular relates to an Agrobacterium binary expression vector, in particular to an Agrobacterium binary expression vector which improves the detection effect of Agrobacterium-infected plants and improves the expression effect of target genes , and its use in promoting the heterologous biosynthesis of amoline in tobacco. Background technique [0002] Terpenoid indole alkaloids are an important class of plant secondary metabolites and important medicinal compounds. Some compounds have been used in the treatment and prevention of human diseases (Wu Shiwen et al., 2018): vinblastine, vinorelbine and vincristine can be used in the treatment of various tumors / cancers; Vindoline and catharanthine are also used in the treatment of diabetes; ajmalicine has anti-inflammatory and blood pressure-lowering effects. However, the content of terpenoid indole alkaloids in pl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/65C12N1/21A01H5/00A01H6/82C12R1/01
CPCC12N15/8205C12N15/8243C12N15/65
Inventor 肖友利吴世文董尚志郑妍
Owner CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More