Detection method for replicative AAV

A detection method and technology to be detected, applied in the directions of microorganism-based methods, biochemical equipment and methods, and microorganism determination/inspection, etc., can solve the problems of false positives, high requirements on the culture environment, and difficulty in reaching the PCR detection limit, etc.

Active Publication Date: 2021-08-27
CHIGENOVO CO LTD
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004]Both detection methods have their own limitations: although direct qPCR detection can directly detect the rep or cap sequence of wild-type AAV packaged in the product, but This is not equivalent to the existence of wild-type AAV. Most of the packaged sequences are incomplete plasmid sequences that have been mispackaged, so there are a lot of false positives in this way; if we locate the qPCR sequence on the packaging plasmid Although the modified ITR-P5 position can avoid false positives, it is difficult

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method for replicative AAV
  • Detection method for replicative AAV
  • Detection method for replicative AAV

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0032] Example 1: Transfection of HEK293T cells and infection

[0033] The first round of infection experiment:

[0034] 1.Day1. HEK293T cells 24 hours prior to digestion, counted per well 1 × 10 6 Cells / 2ml plated to 6 well plates (100ug / ml solution of poly-lysine pretreated -PBS 10min), a total of four holes. Further 1 × 10 6 The cells were plated to 6cm dish passage. At 37 ℃ overnight.

[0035] 2.Day2.4 cell wells, two wells for the holes. Wherein two apertures 2ug pHelper plasmid transfection, two additional holes transfection 1ug pHelper + 1ug pRC8 plasmid.

[0036] 3.Day3. Recombinant AAV virus infection test.

[0037] 4.Day4.PBS washed once with fresh change 1.5ml DMEM-10% FBS media.

[0038] 5.Day5. Culture supernatant was collected in EP tube, centrifuged at room temperature 1.5ml 1000rpm, 5min, remove cells and cell debris. 100ul supernatant was reserved for taking test samples frozen -80 deg.] C; 1ml supernatant was added after the second round to be infected cells ...

Example Embodiment

[0045] Example 2: Cell culture supernatant DNase I treated sample

[0046] The infection process of Example 1 after 4-5 rounds of embodiment, 16 samples to be tested were collected, the samples were as follows:

[0047] 1. Remove from -80 ℃ freezer, thawed at room temperature.

[0048] 2. EP tube disposed in the DNase I mix, without added 640ul water ribozymes, 160ul 10 * DNase IBuffer, 16ul 5U / ul DNase I, pipetted to mix. 8 row successively added two PCR tube.

[0049]3. Add 50 ul Samples (2 times dilution sample) sequentially.

[0050] 4. PCR gauge, 37 ° C for 30 min, 75 ° C 15 min.

[0051] 5. After the treatment, the sample vortex is mixed, and instantaneously centrifuge.

[0052] 6. Take 10 ul sample to add 90 ul of non-ribozyme water (20-fold dilution sample), vortex mix, instantaneous centrifugation.

Example Embodiment

[0053] Example 3: TAQMan QPCR technology to detect RCAAVs in each round of infected cell culture medium

[0054] The processed sample is configured in accordance with the following system: PCR system:

[0055] 2 * aceq qpcr Probe Master Mix 10ul 50 * ROX REFERENCE DYE 1 0.4ul PRIMER F (10UM) 0.4ul Primer R (10UM) 0.4ul TAQMAN Probe (100UM) 0.02ul Template DNA 2ul DDH 2 O

[0056] Rcaav Primer Set:

[0057] ITR-P5-Taqf AgTGGCCAACTCCATCACTA

[0058] ITR-P5-TAQR CCTCTAATACAGGACCTCCCCCTAAC

[0059] ITR-P5-Probe CGTAATTCACGTCACGACTCCCCCCCCCCC

[0060] BGH Primer Set:

[0061] BGH-f ccagccatctgtgttgcc

[0062] BGH-R Actcagacaatgcgatgcaat

[0063] BGH-probe cccgtgccttccttgaccct

[0064] PCR reactions were performed on the ABI7500 as follows:

[0065]

[0066] Since the positive control wells can support recombinant AAV constantly packaged or constantly replicating, we use the BGH on the recombinant AAV genome to characterize the expression titers ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Titeraaaaaaaaaa
Login to view more

Abstract

The invention provides a cytological detection method for rcAAV independent of helper viruses, and the method does not use helper viruses, is safe and friendly to the environment and detection personnel, has extremely high detection sensitivity and accuracy, and has wide application prospects.

Description

technical field [0001] The invention relates to the field of biological detection, and more specifically, the invention relates to a method for detecting replicative AAV. Background technique [0002] Replicating AAV (rcAAV) refers to a vector containing wtAAV rep and cap genes. When the wild-type gene is present, AAV will replicate if the helper virus is present. In addition to AAVs with full replication competence, pseudorecombinant AAVs containing only part of the AAV wild-type genome were also detected. rcAAV and pseudorecombinant AAV are produced by homologous recombination between ITRs and adjacent sequences on the vector plasmid and between viral sequences on the helper plasmid, wtAAV is largely considered non-pathogenic, but through Potential viral DNA transfer by rcAAV or pseudorecombinant AAV creates a risk of AAV Rep proteins with helicase or DNA shearing activity, and their capsid proteins may also trigger cytotoxic T lymphocyte responses. Therefore, for safet...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/85C12N7/00C12Q1/70C12Q1/6851C12R1/93
CPCC12N15/85C12N7/00C12Q1/701C12Q1/6851C12N2800/107C12N2750/14152C12Q2531/113C12Q2561/101Y02A50/30
Inventor 陈邵宏郝丹丹史天永和赛超牛琳琳
Owner CHIGENOVO CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap