Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection method for replicative AAV

A detection method and technology to be detected, applied in the directions of microorganism-based methods, biochemical equipment and methods, and microorganism determination/inspection, etc., can solve the problems of false positives, high requirements on the culture environment, and difficulty in reaching the PCR detection limit, etc.

Active Publication Date: 2021-08-27
CHIGENOVO CO LTD
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004]Both detection methods have their own limitations: although direct qPCR detection can directly detect the rep or cap sequence of wild-type AAV packaged in the product, but This is not equivalent to the existence of wild-type AAV. Most of the packaged sequences are incomplete plasmid sequences that have been mispackaged, so there are a lot of false positives in this way; if we locate the qPCR sequence on the packaging plasmid Although the modified ITR-P5 position can avoid false positives, it is difficult to reach the detection limit of PCR without multiple rounds of culture amplification.
And another way of using helper virus co-infection, although it can solve the two shortcomings of direct PCR detection, but because of the co-infection of wild-type adenovirus or HPV has been used in the detection process, and adenovirus or HPV is harmful to human The susceptibility and pathogenicity of the tester have a certain risk of infection, and the corresponding requirements for the culture environment are also very high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method for replicative AAV
  • Detection method for replicative AAV
  • Detection method for replicative AAV

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1: Transfection and infection of HEK293T cells

[0033] The first round of infection experiment process:

[0034] 1.Day1. Digest HEK293T cells 24 hours in advance, count, according to 1×10 per well 6 Cells / 2ml were spread to 6-well plates (pretreated with 100ug / ml poly-lysine-PBS solution for 10min), a total of 4 wells. Another 1×10 6 The cells were plated to a 6cm dish for passage. Incubate overnight at 37°C.

[0035] 2.Day2.4 wells of cells, 2 wells are duplicate wells. Two of the wells were transfected with 2ug pHelper plasmid, and the other two wells were transfected with 1ug pHelper+1ug pRC8 plasmid.

[0036] 3. Day 3. Infect the recombinant AAV virus to be tested.

[0037] 4.Day4. Wash once with PBS and replace with 1.5ml of fresh DMEM-10% FBS medium.

[0038] 5.Day5. Collect the medium supernatant in a 1.5ml EP tube and centrifuge at 1000rpm for 5min at room temperature to remove cells and cell debris. Take 100ul of the supernatant and freeze it a...

Embodiment 2

[0045] Embodiment 2: Cell culture supernatant sample DNase I treatment

[0046] After 4-5 rounds of the infection process described in Example 1, a total of 16 samples to be tested were collected, and the samples were operated as follows:

[0047] 1. Take it out of the -80°C refrigerator and thaw at room temperature.

[0048] 2. Configure DNase I mix in the EP tube, add 640ul nuclease-free water, 160ul 10*DNase IBuffer, 16ul 5U / ul DNase I, and mix by pipetting. Add to two 8-strip PCR tubes in turn.

[0049]3. Add 50ul samples (2-fold diluted samples) sequentially.

[0050] 4. PCR instrument, 37°C for 30min, 75°C for 15min.

[0051] 5. After the treatment, the samples were vortexed and mixed, and then centrifuged briefly.

[0052] 6. Take 10ul sample and add 90ul nuclease-free water (20 times diluted sample), vortex to mix, and centrifuge briefly.

Embodiment 3

[0053] Example 3: Using taqman qPCR technology to detect rcAAV in the culture supernatant of each round of infected cells

[0054] The processed samples were configured with a PCR system according to the following system:

[0055] 2*AceQ qPCR probe master mix 10ul 50*ROX reference Dye 1 0.4ul Primer F (10uM) 0.4ul Primer R (10uM) 0.4ul Taqman probe(100uM) 0.02ul Template DNA 2ul wxya 2 o

6.8ul Total 20ul

[0056] rcAAV primer SET:

[0057] ITR-P5-taqF AGTGGCCAACTCCATCACTA

[0058] ITR-P5-taqR CCTCTAATACAGGACCTCCCTAAC

[0059] ITR-P5-probe CGTAATTCACGTCACGACTCCACCC

[0060] BGH primer SET:

[0061] BGH-F CCAGCCATCTGTTGTTTGCC

[0062] BGH-R ACTCAGACAATGCGATGCAAT

[0063] BGH-Probe CCCGTGCCTTCCTTGACCCT

[0064] Carry out PCR reaction on ABI7500 according to the following conditions:

[0065]

[0066] Since the positive control wells can support the continuous packaging or continuous replication of recom...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Titeraaaaaaaaaa
Login to View More

Abstract

The invention provides a cytological detection method for rcAAV independent of helper viruses, and the method does not use helper viruses, is safe and friendly to the environment and detection personnel, has extremely high detection sensitivity and accuracy, and has wide application prospects.

Description

technical field [0001] The invention relates to the field of biological detection, and more specifically, the invention relates to a method for detecting replicative AAV. Background technique [0002] Replicating AAV (rcAAV) refers to a vector containing wtAAV rep and cap genes. When the wild-type gene is present, AAV will replicate if the helper virus is present. In addition to AAVs with full replication competence, pseudorecombinant AAVs containing only part of the AAV wild-type genome were also detected. rcAAV and pseudorecombinant AAV are produced by homologous recombination between ITRs and adjacent sequences on the vector plasmid and between viral sequences on the helper plasmid, wtAAV is largely considered non-pathogenic, but through Potential viral DNA transfer by rcAAV or pseudorecombinant AAV creates a risk of AAV Rep proteins with helicase or DNA shearing activity, and their capsid proteins may also trigger cytotoxic T lymphocyte responses. Therefore, for safet...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N7/00C12Q1/70C12Q1/6851C12R1/93
CPCC12N15/85C12N7/00C12Q1/701C12Q1/6851C12N2800/107C12N2750/14152C12Q2531/113C12Q2561/101Y02A50/30
Inventor 陈邵宏郝丹丹史天永和赛超牛琳琳
Owner CHIGENOVO CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com