Mouse anti-MCR-1 protein hybridoma cell strain, monoclonal antibody and application
A hybridoma cell line, MCR-1 technology, applied in the field of antibody preparation, can solve the problems of irrational application of antibiotics, troubles of clinicians choosing antibiotics, and enhancement of bacterial resistance.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0096] Preparation of mouse anti-protein antibody of MCR-1: Example 1
[0097] 1.1 MCR-1 antigen protein preparation
[0098] Find downloaded from NCBI and mcr-1 gene sequence, recombinant plasmids were transformed into E. coli and induced expression; nickel column purification method of affinity chromatography, 6g wet weight bacteria were resuspended in equilibration buffer pH7.4 , clarified broth to ultrasound, high-speed centrifugation, 40.6KDa match the supernatant over a nickel column over the membrane, protein was eluted, and the molecular weight expected, SDS-PAGE, see figure 1 After dispensing quantified using the BCA.
[0099] 1.2 immunized mice
[0100] MCR-1 with purified protein immunized approximately 6 weeks old female Balb / c mice, antibodies prepared, divided into two groups according to the immunization dose, 5 mice per group; antigen content calculated in accordance with a first set of immunization dose 25ug / only, a second set of immunization dose of 50ug / on...
Embodiment 2
[0107] Example 2: anti-murine antibody identification MCR-1 protein
[0108] 2.1 Identification of antibody subclass
[0109] SIGMA according to kit instructions, is to capture ELISA method subclass identification of monoclonal antibodies, as follows: The monoclonal antibody subclass assay reagent 1: 1000 dilution, was added microtiter wells, 100μL / well and incubated for 1h 37 ℃; washed three times with PBST, patted dry; antibody 1: 1000 fold diluted sample was added, 100 μL / well and incubated for 1h 37 ℃; PBST washed three times, and pat dry; the HRP enzyme labeled goat anti-mouse IgG secondary antibody at 1: 10,000 dilution loading, incubated for 30min 100μL / hole, rt; color 10 ~ 20min. Reading at OD450 significantly higher than the other hole based reagent is monoclonal antibody plus nitrous subclass type belongs. 1BH8,1BD9 antibody subtype was IgG1.
[0110] 2.2 Determination of antibody titer
[0111] After indirect ELISA using purified antibody titer determination, the ...
Embodiment 3
[0114] Example 3: mouse anti-protein antibody MCR-1 gene to verify
[0115] RT-PCR was cloned Ig variable region genes, total RNA 1BD9,1BH8 hybridoma cell lines was extracted with Trizol reagent (kit purchased from Invitrogen), using M-MLV Reverse Transcriptase (commercially available from Invitrogen), total RNA was reversed to cDNA library.
[0116] A heavy chain framework region upstream primer
[0117] P1: 5'SAGGTGMAGCTKCASSARTCWGG3 '
[0118] A heavy chain variable region downstream primer
[0119] P2: 5'TGGGGSTGTYGTTTTGGCTGMRGAGACRGTGA3 '
[0120] Light chain leader peptide upstream primer
[0121] P3: 5'ATGGATTTTCAAGTGCAGATTTTCAG3 '
[0122] Downstream of the light chain variable region primer
[0123] P4: 5'GGATACAGTTGGTGCAGCATCAGCCCGTTT3 '
[0124] PCR reaction was prepared (50 l) is as follows:
[0125] cDNA: 2μl; Forward primer (10μM): 2μl; downstream primer (10μM): 2μl; dNTP mixture: 2μl; pfuDNA polymerase (5U / μl): 1μl; 10 X pfu Buffer Ⅱ: 5μl; ddH 2 O: made up to 50μl...
PUM
Property | Measurement | Unit |
---|---|---|
Upstream primer | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap