Mouse anti-MCR-1 protein hybridoma cell strain, monoclonal antibody and application

A hybridoma cell line, MCR-1 technology, applied in the field of antibody preparation, can solve the problems of irrational application of antibiotics, troubles of clinicians choosing antibiotics, and enhancement of bacterial resistance.

Active Publication Date: 2021-09-21
TIANJIN ERA BIOLOGY TECH CO LTD +1
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, the irrational use of antibiotics has led to the continuous enhancement of bacte

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mouse anti-MCR-1 protein hybridoma cell strain, monoclonal antibody and application
  • Mouse anti-MCR-1 protein hybridoma cell strain, monoclonal antibody and application
  • Mouse anti-MCR-1 protein hybridoma cell strain, monoclonal antibody and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0096] Preparation of mouse anti-protein antibody of MCR-1: Example 1

[0097] 1.1 MCR-1 antigen protein preparation

[0098] Find downloaded from NCBI and mcr-1 gene sequence, recombinant plasmids were transformed into E. coli and induced expression; nickel column purification method of affinity chromatography, 6g wet weight bacteria were resuspended in equilibration buffer pH7.4 , clarified broth to ultrasound, high-speed centrifugation, 40.6KDa match the supernatant over a nickel column over the membrane, protein was eluted, and the molecular weight expected, SDS-PAGE, see figure 1 After dispensing quantified using the BCA.

[0099] 1.2 immunized mice

[0100] MCR-1 with purified protein immunized approximately 6 weeks old female Balb / c mice, antibodies prepared, divided into two groups according to the immunization dose, 5 mice per group; antigen content calculated in accordance with a first set of immunization dose 25ug / only, a second set of immunization dose of 50ug / on...

Embodiment 2

[0107] Example 2: anti-murine antibody identification MCR-1 protein

[0108] 2.1 Identification of antibody subclass

[0109] SIGMA according to kit instructions, is to capture ELISA method subclass identification of monoclonal antibodies, as follows: The monoclonal antibody subclass assay reagent 1: 1000 dilution, was added microtiter wells, 100μL / well and incubated for 1h 37 ℃; washed three times with PBST, patted dry; antibody 1: 1000 fold diluted sample was added, 100 μL / well and incubated for 1h 37 ℃; PBST washed three times, and pat dry; the HRP enzyme labeled goat anti-mouse IgG secondary antibody at 1: 10,000 dilution loading, incubated for 30min 100μL / hole, rt; color 10 ~ 20min. Reading at OD450 significantly higher than the other hole based reagent is monoclonal antibody plus nitrous subclass type belongs. 1BH8,1BD9 antibody subtype was IgG1.

[0110] 2.2 Determination of antibody titer

[0111] After indirect ELISA using purified antibody titer determination, the ...

Embodiment 3

[0114] Example 3: mouse anti-protein antibody MCR-1 gene to verify

[0115] RT-PCR was cloned Ig variable region genes, total RNA 1BD9,1BH8 hybridoma cell lines was extracted with Trizol reagent (kit purchased from Invitrogen), using M-MLV Reverse Transcriptase (commercially available from Invitrogen), total RNA was reversed to cDNA library.

[0116] A heavy chain framework region upstream primer

[0117] P1: 5'SAGGTGMAGCTKCASSARTCWGG3 '

[0118] A heavy chain variable region downstream primer

[0119] P2: 5'TGGGGSTGTYGTTTTGGCTGMRGAGACRGTGA3 '

[0120] Light chain leader peptide upstream primer

[0121] P3: 5'ATGGATTTTCAAGTGCAGATTTTCAG3 '

[0122] Downstream of the light chain variable region primer

[0123] P4: 5'GGATACAGTTGGTGCAGCATCAGCCCGTTT3 '

[0124] PCR reaction was prepared (50 l) is as follows:

[0125] cDNA: 2μl; Forward primer (10μM): 2μl; downstream primer (10μM): 2μl; dNTP mixture: 2μl; pfuDNA polymerase (5U / μl): 1μl; 10 X pfu Buffer Ⅱ: 5μl; ddH 2 O: made up to 50μl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Upstream primeraaaaaaaaaa
Login to view more

Abstract

The invention provides a mouse anti-MCR-1 protein hybridoma cell strain, a monoclonal antibody and application. Ig variable region genes are cloned through mouse hybridoma monoclonal antibody screening and an RT-PCR method, and a hybridoma cell strain capable of stably secreting a mouse anti-MCR-1 protein antibody and a variable region sequence of the hybridoma cell strain are obtained. Systematic evaluation shows that the mouse anti-MCR-1 protein antibody has better performance in all aspects, so that the mouse anti-MCR-1 protein antibody is suitable for being used as an immunodiagnostic reagent for in-vitro diagnosis of MCR-1 protein antigen, the titer reaches 1: 1280000 or above, and the mouse anti-MCR-1 protein antibody is used for developing related in-vitro diagnostic reagents.

Description

Technical field [0001] The invention belongs to the technical field of antibody preparation, and more particularly to a mouse anti-MCR-1 protein hybrid tumor cell line, monoclonal antibody and application. Background technique [0002] Immunology reagents are the fastest segments in in vitro diagnostic reagents, qualitative or quantitative detection using the specific binding between antigens and antibodies. [0003] Polymyxin is currently used in the final choice for clinical treatment of multi-drug and pan-resistant Gram-negative bacterial infections. In recent years, due to the increase in clinical use of polymyxin, the number of drug resistant strains has increased year by year. Although the current bacteria is not strong in polyprisperin resistance, it is possible to lead to the neutralization of medical treatment, how to effectively curb the spread of drug resistance into a global public relations. [0004] In a variety of drugs, the lipid a-phosphate anmia (PETN) is mediat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N5/20C12N15/13C07K16/28G01N33/74G01N33/58G01N33/577G01N33/558C12R1/91
CPCC07K16/2869G01N33/74G01N33/587G01N33/577G01N33/558C07K2317/56C07K2317/565G01N2333/72C07K16/1232G01N2800/52G01N2800/24G01N33/6893
Inventor 苑庆华何永胜李可可夏斌陈晓玲王亚苗孔迪王思怡
Owner TIANJIN ERA BIOLOGY TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap