Application of photoperiod gene OsNhd1

A photoperiod and gene technology, applied in the field of genetic engineering technology and botany, to achieve the effects of improving nitrogen use efficiency, increasing yield, and prolonging the growth period

Active Publication Date: 2021-09-24
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, most studies on the mechanism of external influences on flowering have focused on factors such a

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of photoperiod gene OsNhd1
  • Application of photoperiod gene OsNhd1
  • Application of photoperiod gene OsNhd1

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Construction and Identification of Example 1 Gene OsNhd1 Mutants and Overexpression Plants

[0029] According to the gene sequence, the CRISPR-Cas9 system was used to design targeting sequences located on the 2nd and 4th exons of OsNhd1 respectively, and primers were designed, and the primer sequences were:

[0030] P1-F: 5' GGCA TTCACCTTCTATGCGCTGCC (SEQ ID NO. 3)

[0031] P1-R: 3' AAAC GGCAGCGCATAGAAGGTGAA (SEQ ID NO. 4)

[0032] P2-F: 5' GGCA GCATTGATTCATAGTTCCGC (SEQ ID NO. 5)

[0033] P2-R: 3' AAAC GCGGAACTATGAATCAATGC (SEQ ID NO. 6)

[0034] The forward and reverse primers were mixed 1:1 after diluting the primers 100 times with TE buffer. Gradient annealing to obtain double-stranded DNA with cohesive ends, the annealing temperature and time are as follows. 95°C for 30sec; 75°C for 2min; 37°C for 2min; 25°C for 2min. The pOs-sgRNA vector (Miao J, Guo D, Zhang J, et al., 2013. Targeted mutagenesis in rice using CRISPR-Cas system. Cell Res 23, 1233-6.) wa...

Embodiment 2

[0035] Example 2 Field Yield and Nitrogen Use Efficiency Evaluation of OsNhd1

[0036] The OsNhd1 mutant strain and its original background Nippon Haru wild-type material were planted in transgenic experimental bases in Hainan (short day) and Nanjing (long day) with one plant per hole at an interval of 20cm*15cm, and low There are two levels of nitrogen supply and higher nitrogen supply. In Hainan, set the nitrogen level of 90 kg / mu as low nitrogen (LN), and 180 kg / mu as medium nitrogen (NN); in Nanjing, set the nitrogen level of 180 kg / mu as medium nitrogen (NN), 360 kg Set to High Nitrogen (HN) per acre.

[0037] The yield per plant of each mutant line and wild type was analyzed separately. And whole plant samples of each material were collected at maturity. After drying, digesting and measuring, the nitrogen use efficiency is calculated. The calculated nitrogen use efficiency includes nitrogen uptake efficiency (total nitrogen uptake by plants per hectare ÷ total nitrog...

Embodiment 3

[0038] Example 3 Regulation of OsNhd1 on rice heading, flowering and growth period

[0039] 1) Construction and identification of OsNhd1 overexpression transgenic lines. The first 3000 bp of the start codon of OsNhd1 was intercepted as the promoter (SEQ ID NO.1), and the full-length cDNA of OsNhd1 was connected and cloned into the pTCK303 vector. The sequence of the amplification primer (plus multiple cloning restriction sites) was P3-F: ACTAGT ATGGAGATTAATTCCTCTGG (SEQ ID NO. 7) and P3-R: ACTAGT TCATGTCGATGCTTCGCTCT (SEQ ID NO. 8). The Nipponbare-background transgenic lines were obtained by Agrobacterium-mediated plant transgenic process. The expression kurtosis of OsNhd1 in different strains was detected by fluorescent quantitative PCR ( figure 1 ), and then use hyb as a probe to obtain a single-copy strain ( figure 1 ).

[0040] 2) Observation of the growth period of OsNhd1 overexpression lines, mutant lines and Nippon Haruno type field planting

[0041] The OsNhd1 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an application of a photoperiod gene OsNhd1. Rice (oryza sativa) photoperiod gene OsNhd1 is applied to regulation and control of the growth period, the yield and the nitrogen utilization efficiency of rice; and the rice photoperiod gene OsNhd1 is numbered as Os8g0157600 in an RAP-DB (Rice Annotation Project Database). According to the application, an OsNhd1 mutant plant is obtained through a gene knockout technology. Field tests and analysis prove that the mutant plant has the characteristics of prolonged growth period, increased yield and increased nitrogen utilization efficiency. The application proves that OsNhd1 not only directly regulates heading and flowering of rice, but also participates in nitrogen assimilation and transport processes of rice, which indicates that the gene plays an important role in coordinated regulation of growth period and nitrogen utilization efficiency, and establishes a theoretical basis for improvement of rice varieties in the future.

Description

technical field [0001] The invention relates to the fields of genetic engineering technology and botany, in particular to the application of the key photoperiod gene OsNhd1 in regulating the growth period of rice to improve yield and nitrogen use efficiency. Background technique [0002] The high yield and high quality of modern crops are very dependent on the application of nitrogen fertilizer. Excessive nitrogen fertilizer not only leads to a series of production and environmental problems, but also affects crop growth and growth period, thereby affecting yield and nitrogen use efficiency. The length of the growth period will directly affect the pollination process of plants and the time of seed development, etc., and plays a vital role in crop yield and quality. Moderately prolonging the growth period can increase light energy, nutrient, water use efficiency and yield, but late maturing of greenery will lead to excessive vegetative growth, delayed reproductive growth, di...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/02A01H6/46
CPCC07K14/415C12N15/827C12N15/8261
Inventor 徐国华张抒南张誉译骆乐
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap