Rubber tree ubiquitin gene promoter proHbUBI1 and cloning and application thereof
A technology of ubiquitin gene, prohbubi1-hgfp-pc3301, applied in the field of genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1 Obtaining of Hevea brasiliensis ubiquitin gene promoter proHbUBI1
[0045] Taking the full-length CDS sequence of the rice OsUBI10 gene (Genebank accession number: XM_015769228.1) as a reference, we searched the rubber tree genome database we established, and found a rubber tree ubiquitin gene with a homology greater than 80% ( Genebank accession number: XM_021810009.1), and named it HbUBI1. The comparison of the nucleotide sequence of the rubber tree HbUBI1 gene and the rice OsUBI10 gene coding region is as follows: figure 1 As shown, the results show that the rubber tree HbUBI1 gene has a very high sequence homology with the rice OsUBI10.
[0046] Using the rubber tree gene expression database (http: / / hevea.catas.cn / tool / v1 / toExpression) to obtain the expression pattern of the HbUBI1 gene, it was found that the gene is present in most tissues (such as leaves, bark, latex, etc.) of the main rubber tree strains. , lactiferous ducts, flowers and seeds, etc.) ...
Embodiment 2
[0053] The construction of embodiment 2 rubber tree transient expression vectors
[0054] In this example, the obtained promoter proHbUBI1 was constructed on the transient expression vector pJIT163-hGFP to replace the 2×35S promoter on the vector, specifically including the following steps:
[0055] (1) Design the following primers to introduce SacI and NcoI restriction sites at the 5' and 3' ends of the proHbUBI1 sequence respectively. The primers are designed as follows:
[0056] proHbUBI1-sF: AGCGAGCTCATGCCTTACCTTTGGCAGTG;
[0057] proHbUBI1-nR: ATGCCATGGCTGATCACAAAATAACAAAAC;
[0058] (2) Using the rubber tree genomic DNA as a template, use KOD FX enzyme (TOYOBO) to carry out PCR amplification in a 20 μl reaction system. The specific reaction procedure is: pre-denaturation at 95°C for 2 minutes, denaturation at 98°C for 10 seconds, annealing at 56°C for 30 seconds, and 72°C Extend for 2 minutes, 35 cycles, and finally extend for 5 minutes at 72°C; purify and recover the ...
Embodiment 3
[0060] The construction of embodiment 3 Hevea stable transformation expression vector
[0061] In this example, the promoter proHbUBI1 was constructed into the stable transformation expression vector pCAMBIA3301, specifically by further constructing the proHbUBI1::hGFP expression cassette on the transient expression vector proHbUBI1-163hGFP prepared in Example 2 into the stable transformation vector pCAMBIA3301 , specifically include the following steps:
[0062] (1) Design primers to introduce SacI and PstI restriction sites at the 5' and 3' ends of the proHbUBI1::hGFP expression cassette respectively. The primers were designed as follows:
[0063] proHbUBI1-sF: AGCGAGCTCATGCCTTACCTTTGGCAGTG;
[0064] CaMVT-pR: CCCTGCAGCGGTGTGAGGGAACTAG;
[0065] (2) Using the prepared proHbUBI1-163hGFP plasmid DNA as a template, use KOD FX enzyme (TOYOBO) to carry out PCR amplification in a 20 μl reaction system; the specific reaction program is: pre-denaturation at 95°C for 2 minutes, den...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com