Rubber tree ubiquitin gene promoter proHbUBI1 and cloning and application thereof

A technology of ubiquitin gene, prohbubi1-hgfp-pc3301, applied in the field of genetic engineering

Active Publication Date: 2021-10-19
RUBBER RES INST CHINESE ACADEMY OF TROPICAL AGRI SCI
View PDF12 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no report on the application of the endogenous constitutive ubiquitin gene promoter in the rubber tree genetic transformation system.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rubber tree ubiquitin gene promoter proHbUBI1 and cloning and application thereof
  • Rubber tree ubiquitin gene promoter proHbUBI1 and cloning and application thereof
  • Rubber tree ubiquitin gene promoter proHbUBI1 and cloning and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Obtaining of Hevea brasiliensis ubiquitin gene promoter proHbUBI1

[0045] Taking the full-length CDS sequence of the rice OsUBI10 gene (Genebank accession number: XM_015769228.1) as a reference, we searched the rubber tree genome database we established, and found a rubber tree ubiquitin gene with a homology greater than 80% ( Genebank accession number: XM_021810009.1), and named it HbUBI1. The comparison of the nucleotide sequence of the rubber tree HbUBI1 gene and the rice OsUBI10 gene coding region is as follows: figure 1 As shown, the results show that the rubber tree HbUBI1 gene has a very high sequence homology with the rice OsUBI10.

[0046] Using the rubber tree gene expression database (http: / / hevea.catas.cn / tool / v1 / toExpression) to obtain the expression pattern of the HbUBI1 gene, it was found that the gene is present in most tissues (such as leaves, bark, latex, etc.) of the main rubber tree strains. , lactiferous ducts, flowers and seeds, etc.) ...

Embodiment 2

[0053] The construction of embodiment 2 rubber tree transient expression vectors

[0054] In this example, the obtained promoter proHbUBI1 was constructed on the transient expression vector pJIT163-hGFP to replace the 2×35S promoter on the vector, specifically including the following steps:

[0055] (1) Design the following primers to introduce SacI and NcoI restriction sites at the 5' and 3' ends of the proHbUBI1 sequence respectively. The primers are designed as follows:

[0056] proHbUBI1-sF: AGCGAGCTCATGCCTTACCTTTGGCAGTG;

[0057] proHbUBI1-nR: ATGCCATGGCTGATCACAAAATAACAAAAC;

[0058] (2) Using the rubber tree genomic DNA as a template, use KOD FX enzyme (TOYOBO) to carry out PCR amplification in a 20 μl reaction system. The specific reaction procedure is: pre-denaturation at 95°C for 2 minutes, denaturation at 98°C for 10 seconds, annealing at 56°C for 30 seconds, and 72°C Extend for 2 minutes, 35 cycles, and finally extend for 5 minutes at 72°C; purify and recover the ...

Embodiment 3

[0060] The construction of embodiment 3 Hevea stable transformation expression vector

[0061] In this example, the promoter proHbUBI1 was constructed into the stable transformation expression vector pCAMBIA3301, specifically by further constructing the proHbUBI1::hGFP expression cassette on the transient expression vector proHbUBI1-163hGFP prepared in Example 2 into the stable transformation vector pCAMBIA3301 , specifically include the following steps:

[0062] (1) Design primers to introduce SacI and PstI restriction sites at the 5' and 3' ends of the proHbUBI1::hGFP expression cassette respectively. The primers were designed as follows:

[0063] proHbUBI1-sF: AGCGAGCTCATGCCTTACCTTTGGCAGTG;

[0064] CaMVT-pR: CCCTGCAGCGGTGTGAGGGAACTAG;

[0065] (2) Using the prepared proHbUBI1-163hGFP plasmid DNA as a template, use KOD FX enzyme (TOYOBO) to carry out PCR amplification in a 20 μl reaction system; the specific reaction program is: pre-denaturation at 95°C for 2 minutes, den...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene engineering, particularly relates to a rubber tree endogenous constitutive promoter, more particularly relates to a rubber tree ubiquitin gene promoter proHbUBI1, and further discloses a cloning method and application of the rubber tree ubiquitin gene promoter proHbUBI1. According to the rubber tree endogenous constitutive promoter, a highly-conservative rubber tree ubiquitin gene is screened from a Brazil rubber tree genome through nucleotide sequence alignment, a rubber tree ubiquitin gene promoter proHbUBI1 is obtained by further cloning an upstream promoter of an initiation codon ATG of an HbUBI1 gene, and the promoter is a rubber tree endogenous constitutive promoter. The promoter has efficient transcriptional activity in a plurality of tissues of the rubber tree in different development stages, can be used for driving expression of exogenous genes, and can be applied to a rubber tree transgenic system and a genetic transformation system, so that efficient and accurate variety improvement of the rubber tree is realized.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, specifically relates to a rubber tree endogenous constitutive promoter, more specifically relates to a rubber tree ubiquitin gene promoter proHbUBI1, and further discloses its cloning method and application. Background technique [0002] The Brazilian rubber tree (Hevea Brasiliensis) is an important commercial crop and the only commercial source of natural rubber. As a perennial cross-pollinated tree species, rubber tree has a relatively long young age, and it is mostly genetically improved through traditional cross-breeding. However, due to the slow growth of rubber tree itself, conventional breeding has the problems of low efficiency and long cycle, which is a serious problem. Hindered the process of rubber tree breeding. With the development of biotechnology, the application of molecular breeding technology in rubber trees has accelerated the cultivation of new varieties of rubber...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/10C12N15/84C12N15/66C12N15/65A01H5/00A01H6/38
CPCC07K14/415C12N15/10C12N15/8216C12N15/8212C12N15/8205C12Q2531/113Y02A50/30
Inventor辛士超顾晓川吉努乌达亚巴努华玉伟戴雪梅杨先锋黄华孙
OwnerRUBBER RES INST CHINESE ACADEMY OF TROPICAL AGRI SCI