Check patentability & draft patents in minutes with Patsnap Eureka AI!

In-situ hybridization probe complex as well as preparation method and application thereof

A hybridization probe, in situ hybridization technology, applied in biochemical equipment and methods, DNA/RNA fragments, microorganism determination/inspection, etc. question

Active Publication Date: 2021-10-22
GENE TECH SHANGHAI COMPANY
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, longer hybridization probes are prone to non-specific binding of hybridization probes under mild hybridization conditions (such as incubation at 37-50°C), resulting in deepened background signals of color development and affecting the judgment of staining results.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • In-situ hybridization probe complex as well as preparation method and application thereof
  • In-situ hybridization probe complex as well as preparation method and application thereof
  • In-situ hybridization probe complex as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] Embodiment 1, detect the in situ hybridization probe complex design of EBER gene expression in the Epstein-Barr virus

[0070] Epstein-Barr virus is a ubiquitous human herpes virus that can infect about 95% of adults worldwide, most of whom will not show any clinical symptoms. However, latently infected Epstein-Barr virus can lead to malignant tumors in some cases, including lymphoma derived from B cells and nasopharyngeal carcinoma derived from epithelial cells. The Epstein-Barr virus genome size is about 170kb. In addition to transcribing a series of protein-coding genes, it can also encode some small RNAs, the most important of which are small RNA-1 (Epstein-Barr virus encoded small RNA 1, referred to as EBER-1) and small RNA-2 (Epstein-Barr virus encoded small RNA 2, referred to as EBER-2). The expression level of EBER is closely related to the recurrence, metastasis and prognosis of tumor patients.

[0071] The target genes of in situ hybridization are EBER-1 and...

Embodiment 2

[0080] (2) Probe combination 1 of the present invention (used in Example 2), comprising:

[0081] N1-EBER-1Probe:

[0082] CGGCAGAAAGCAGAGTCTGGGAAGACAACC(SEQ ID NO:3)-Spacer-CCAAGACCACTCGTGAAGACAGCACTGAAG(SEQ ID NO:5), probe binding region (SEQ ID NO:3) length 30base, complementary pairing region (SEQ ID NO:5) length 30base, inter-arm connection The region (Spacer) is ligated with 2 tetrahydrofuran, and the 5' and 3' ends are labeled with digoxigenin.

[0083] N1-EBER-2Probe:

[0084] GCAAATGCTCTAGGCGGGAAGCCTCTCTTC (SEQ ID NO: 4) - Spacer-CTTCAGTGCTGTCTTCACGAGTGGTCTTGG (SEQ ID NO: 6). The length of the probe binding region (SEQ ID NO:4) is 30base, the length of the complementary pairing region (SEQ ID NO:6) is 30base (complementary pairing with SEQ ID NO:5), and the spacer of the interarm is connected with 2 tetrahydrofuran , 5' and 3' ends were labeled with digoxigenin.

Embodiment 3

[0085] (3) Probe combination 2 of the present invention (for Example 3), comprising:

[0086] N2-EBER-1Probe:

[0087] CGGCAGAAAGCAGAGTCTGGGAAGACAACC(SEQ ID NO:3)-Spacer-CCAAGACCACTCGTGAAGACAGCACTGAAG(SEQ ID NO:5), probe binding region (SEQ ID NO:3) length 30base, complementary pairing region (SEQ ID NO:5) length 30base, inter-arm connection Area (Spacer) uses 6 CH 2 Ligation is performed and the 5' and 3' ends are labeled with digoxigenin.

[0088] N2-EBER-2Probe:

[0089] GCAAATGCTCTAGGCGGGAAGCCTCTCTTC (SEQ ID NO:4)-Spacer-CTTCAGTGCTGTCTTCACGAGTGGTCTTGG (SEQ ID NO:6). The length of the probe binding region (SEQ ID NO: 4) is 30base, the length of the complementary pairing region (SEQ ID NO: 6) is 30base (complementary pairing with SEQ ID NO: 5), and the inter-arm connecting region (Spacer) uses 6 CH 2 Ligation is performed and the 5' and 3' ends are labeled with digoxigenin.

[0090] In the above three sets of probe combinations, the length and sequence of the probe-bind...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an in-situ hybridization probe complex as well as a preparation method and application thereof. The invention discloses an optimized in-situ hybridization probe complex which consists of a hybridization probe 1 and a hybridization probe 2, each probe comprises three parts, namely a probe binding region, a spacer arm connecting region and a complementary pairing region, and the 5'and 3 'ends are marked by detectable markers. The hybridization probe 1 and the hybridization probe 2 form a probe complex through a complementary pairing region, and the complex can be combined with two groups of target gene segments and carries four detectable markers. According to the technical scheme, the dyeing intensity of a positive sample can be remarkably improved, and background signals of in-situ hybridization dyeing can be effectively reduced, so that the accuracy of sample detection is improved.

Description

technical field [0001] The invention belongs to the field of gene detection; more specifically, the invention relates to an in situ hybridization probe complex prepared for immunohistochemical detection, its preparation method and application. Background technique [0002] In situ hybridization is a method of accurately positioning nucleic acids by using specific labeled known nucleic acid sequences as probes to hybridize with nucleic acid sequences on cells or tissue sections. Therefore, in situ hybridization can be used to obtain information on the location and abundance of specific nucleic acids in cells. In this method, a nucleic acid probe complementary to the sequence of the nucleic acid molecule to be tested is dissolved in a hybridization buffer, and dropped onto a protease-digested tissue section, so that the nucleic acid probe is combined with the target nucleic acid molecule. Labels for detection (such as fluorescent labels, digoxigenin labels, etc.) are attached...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12Q1/70C12Q1/6841
CPCC12Q1/701C12Q1/6841C12Q2563/131C12Q2543/10
Inventor 王东李宾张涛谢桂贞沈邢
Owner GENE TECH SHANGHAI COMPANY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com