Method for constructing X-linked hypophosphatemic rickets mouse model
A mouse model, rickets technology, applied in the field of gene editing, can solve the problems of abnormal bone mineralization, functional defects, PHEX protein cannot be folded, etc., and achieve the effect of stable inheritance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1, Construction of sgRNA expression vector inserted with mouse PHEX gene editing target site at T1 and T2 sites
[0022] (1) Sources of main reagents and materials
[0023] The pDR274 vector was purchased from Addgene. Single-stranded oligos were synthesized by Shenzhen Huada Gene Co., Ltd. BsaI restriction endonuclease was purchased from Fermentas. T4 DNA ligase was purchased from Fermentas. DH5α competent cells were purchased from Beijing Tiangen Biotechnology Co., Ltd. The recombinant vector was carried out in accordance with the instructions of the small-scale ultra-pure plasmid extraction kit provided by Beijing Tiangen Biotechnology Co., Ltd. DNA tapping gel recovery kit was purchased from Qiagen. Sequencing was entrusted to Shenzhen Huada Gene Co., Ltd. to complete.
[0024] (2) Operation steps
[0025] 1. Restriction endonuclease BsaI digests the plasmid PDR274 vector, and the reaction system is shown in Table 1:
[0026] Table 1 Reaction system ...
Embodiment 2
[0042]Example 2, sgRNA in vitro transcription
[0043] (1) Sources of main reagents and materials
[0044] PCR primers were synthesized by Huada Gene Co., Ltd. DNA tapping gel recovery kit was purchased from Qiagen. MEGAshortscript kit (AM1354) sgRNA in vitro transcription kit was purchased from Ambion. Taq enzyme and 10×PCRBuffer were purchased from Dalian Bao Biological Engineering Co., Ltd.
[0045] (2) Operation steps
[0046] 1. Preparation of gRNA template for in vitro transcription
[0047] Use the sgRNA expression plasmid as a template for PCR. The sequence of the sgRNA is: TTTCTCCAGCATGTCAATGA (SEQ ID NO.1). The reaction system is shown in Table 5:
[0048] Table 5 PCR reaction system using sgRNA expression plasmid as template
[0049] components Dosage 10×buffer 2μL dNTP 1.6μL Upstream primer (10uM) 1μL Downstream primer (10uM) 1μL rTaq enzyme 0.2 μL Cas9 gRNA expression plasmid 1μL DEPC H2O Up to 20μ...
Embodiment 3
[0060] Embodiment 3, mouse zygote microinjection
[0061] (1) Sources of main reagents and materials
[0062] The experimental animals were SPF grade Kunming mice purchased from the Experimental Animal Center of Hubei Academy of Medical Sciences [production license SCXK (E) 2003205]. Pregnant horse serum gonadotropin (PMSG) and human chorionic gonadotropin (HCG) were purchased from Ningbo Sansheng Pharmaceutical Co., Ltd., and hyaluronidase was purchased from Shanghai Biological Products Factory. M2, M16 cell culture medium is self-made.
[0063] (2) Operation steps
[0064] Superovulation of donor mice and recipient mice: select 6-week-old female mice weighing more than 30 g, intraperitoneally inject 5-10 IU PMSG, and then inject 5-10 IU HCG for super-ovulation 46-48 hours after injection. On the day of HCG injection, the donor mice were caged with the breeding male mice, and the recipient mice were caged with the ligated male mice. The vaginal plugs were checked the next ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More