BRV serum neutralizing antibody titer level detection method based on IFA
A detection method and antibody titer technology, applied in the biological field, can solve problems such as difficulty in accurately detecting antibody titer levels, and achieve representative, specific, and short detection cycles
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Embodiment 1: BRV virus collection, identification and cultivation
[0032] 1.1. Collect the excreta of calves suspected of being infected with BRV from Hohhot, Inner Mongolia. After repeated dissolving with 1ml PBS, freeze-thaw three times, 3000r / min, centrifuge for 10min and take the supernatant as a virus sample. Use a nucleic acid extraction kit ( Tiangen), extract the double-stranded RNA in the virus sample, and then reverse-transcribe the RNA into cDNA, and use the BRV target gene primer designed by DNAman (the length of the amplified target band should be 1062bp) to identify the cDNA. Wherein the BRV target gene primer sequence is:
[0033] BRV-F: 5'GGCTTTAATTGCGAGAATTTCC 3' (SEQ ID NO: 1);
[0034] BRV-R: 5'GGTCTCATCATTCAACTCTAAT 3' (SEQ ID NO:2);
[0035] 1.2. Use the above primers to perform PCR amplification using the reverse-transcribed cDNA as a template. The specific amplification system is: 2 μl template, 0.5 μl BRV upstream primer (BRV-F), 0.5 μl BRV d...
Embodiment 2
[0038] Embodiment 2: Preparation of BRV neutralizing poison
[0039] 2.1. MA104 monolayer cells (preserved in the laboratory of Jinyu Baoling Biopharmaceutical Co., Ltd., commercially available) were prepared into 2×10 cells by digestion and passage. 5 cells / ml cell suspension, according to 150 μL of cell suspension spread in the wells of 96-well plate, at 37 ℃, 5% CO 2 After culturing in the incubator for 24 h, after the cells grew into a single layer, the surface layer of the cells was washed with DMEM maintenance solution containing 5 μg / ml trypsin (gibco company), and 100 μL of DMEM maintenance solution containing 5 μg / ml trypsin was added to each well. Obtain cell plates plated with MA104 monolayer cells.
[0040] 2.2. The BRV virus liquid obtained in Example 1 was serially diluted 10 times with DMEM maintenance solution containing 5 μg / ml trypsin, from 10 -1 ~10 -8 Inoculate the virus solution of each diluted titer into the wells of the monolayer cell plate treated in...
Embodiment 3
[0048] Embodiment 3: Determination of neutralization reaction conditions in the IFA neutralizing antibody detection method of BRV
[0049] 3.1. Determination of trypsin concentration in maintenance solution when clinical serum samples are diluted
[0050] Negative for BRV neutralizing antibody using DMEM maintenance solution containing 20 μg / ml, 40 μg / ml, 60 μg / ml, 80 μg / ml, 100 μg / ml, 120 μg / ml, 140 μg / ml, 160 μg / ml, 180 μg / ml trypsin Serum samples (gibco fetal bovine serum) were serially diluted 2-fold to a dilution of 1:128 to obtain serial dilutions of serum samples obtained by dilution with DMEM maintenance solution containing different concentrations of trypsin. Serum samples of each dilution were mixed with an equal amount of 200TCID 50 After neutralizing BRV neutralizing virus (prepared in Example 2) for 1 h, inoculate 100 μl of the neutralized mixed solution into the wells of the cell plate (prepared in step 2.1 in Example 2) covered with MA104 monolayer cells, and ...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com