Method for creating high-anthocyanin horticultural ornamental poplar by utilizing miR156

A kind of anthocyanin and poplar technology, applied in the field of plant genetic engineering, can solve the problem of single color of poplar, achieve the effects of increasing branches, small leaves, and improving stress resistance

Active Publication Date: 2021-12-10
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, limited by the height of some green spaces, poplars as landscape plants need to be pruned so that the height of individual plants meets the requirements of the overall landscape and ecology; in addition, the color of poplars is relatively single; therefore, it is necessary to consider the tree shape and Seek ways to improve the horticultural ornamental value of poplar by starting with color

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for creating high-anthocyanin horticultural ornamental poplar by utilizing miR156
  • Method for creating high-anthocyanin horticultural ornamental poplar by utilizing miR156
  • Method for creating high-anthocyanin horticultural ornamental poplar by utilizing miR156

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] The poplar transgenic plant with up-regulated expression of embodiment 1 miR156 was obtained

[0039] 1. Pre-MtmiR156b overexpression vector construction

[0040] (1) Use the DNA of alfalfa R108 as a template (the partial sequence of the template is shown in SEQ ID NO.3), and use HiFi high-fidelity amplification enzyme and primers pre-MtmiR156b-F, pre-MtmiR156b-R to clone the precursor of alfalfa miR156 miR156b.

[0041] pre-MtmiR156b-F: CACCCTTCCTCAGACAACAACAAG, SEQ ID NO.4;

[0042] pre-MtmiR156b-R: CTGGTGGTAGGATTTTTGTCA, SEQ ID NO.5.

[0043] (2) Digest the pCXSN plasmid with XcmI.

[0044] (3) Ligate the amplified fragment in step (1) with the digested pCXSN in step (2) with T4 ligase to obtain the overexpression vector pCXSN-pre- MtmiR156b.

[0045] 2. Obtaining of transgenic plants

[0046] The overexpression vector pCXSN-pre-MtmiR156b was genetically transformed into the hybrid poplar variety 84K through the mediation of Agrobacterium EHA105, so as to up-re...

Embodiment 2

[0078] Example 2: Determination of anthocyanin content in poplar transgenic plants with up-regulated expression of miR156

[0079] 10-month-old wild-type plants and transgenic plants overexpressing miR156 were selected, samples were taken from the tops of poplar trees, and sent to Maiwei Metabolism for metabolomics analysis.

[0080] Such as image 3 As shown, the epidermis of stems, leaf margins and petioles of poplar transgenic plants with up-regulated expression of miR156 are red, while wild-type plants are all green. It can be seen that the content of anthocyanins in the stems, leaf margins and petioles of transgenic plants has increased.

[0081] Further, as Figure 4 As shown, the results of metabolomics analysis showed that the anthocyanin content in the transgenic plants was significantly higher than that in the wild-type plants. At the same time, the content of other flavonoids in the phenylpropanoid metabolic pathway to which anthocyanins belong is also significant...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for creating a high-anthocyanin horticultural ornamental poplar by utilizing miR156, and belongs to the technical field of plant genetic engineering. An overexpression vector is constructed by utilizing a precursor miR156b, the overexpression vector is transformed into poplar leaves through an agrobacterium-mediated method, and miR156 is overexpressed in the poplar. The expression quantity of miR156 of the obtained transgenic plant is remarkably increased, the anthocyanin content is remarkably increased, the plant is dwarfed, the leaves and branches are increased, and then the horticultural ornamental value of the poplar is improved.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering, and more specifically relates to a method for creating high-anthocyanidin horticultural ornamental poplars by using miR156. Background technique [0002] The ornamental value of horticultural landscape trees is mainly reflected in tree shape and color. Poplar is tall and straight, with large leaves and thick shade, fast growth and strong adaptability. It is an excellent greening tree species and has certain ornamental value. However, limited by the height of some green spaces, poplars as landscape plants need to be pruned so that the height of individual plants meets the requirements of the overall landscape and ecology; in addition, the color of poplars is relatively single; therefore, it is necessary to consider the tree shape and Color started looking for ways to enhance the horticultural ornamental value of poplars. [0003] microRNA (miRNA) is a kind of endogenous non-cod...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/82C12N15/113A01H5/00A01H5/04A01H5/12A01H6/00
CPCC12N15/8218C12N15/825
Inventor付春祥王亚梅刘文文吴振映杨瑞娟王寒李玉姜珊珊林金星王鑫伟
OwnerQINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI