Supercharge Your Innovation With Domain-Expert AI Agents!

Application of Chi3l1 in regulation and control of immune regulation effect of hUC-MSCs for inhibiting Th17 differentiation meditation

A technology of immune regulation and action, applied in the biological field, can solve the problems such as unclear main mechanism of action of aGvHD

Active Publication Date: 2021-12-14
ACADEMY OF MILITARY MEDICAL SCI
View PDF14 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far, whether this theory applies to MSCs from all tissue sources, and whether it is the main mechanism of action of hUC-MSCs in the treatment of aGvHD is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Chi3l1 in regulation and control of immune regulation effect of hUC-MSCs for inhibiting Th17 differentiation meditation
  • Application of Chi3l1 in regulation and control of immune regulation effect of hUC-MSCs for inhibiting Th17 differentiation meditation
  • Application of Chi3l1 in regulation and control of immune regulation effect of hUC-MSCs for inhibiting Th17 differentiation meditation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Inflammatory factors IFN-γ combined with TNF-α stimulate hUC-MSCs to highly express Chi3l1

[0028] The inflammatory factor IFN-γ combined with TNF-α (20ng / ml) stimulated hUC-MSCs for 24h, 48h, and 72h, respectively, and then the total RNA, total protein and supernatant protein of the cells were extracted, and the real-time fluorescent quantitative PCR technology (q-PCR ) and Western Blot to detect the expression of Chi3l1.

[0029]

[0030] like figure 1 As shown in A, in mesenchymal stem cells derived from human bone marrow (Bm-MSC), amniotic membrane (Hm-MSC), placenta (Hp-MSC), and umbilical cord (Hu-MSC), Chi3l1 is highly expressed in hUC-MSCs; as figure 1 As shown in B, the expression of Chi3l1 is high after stimulation of hUC-MSCs by inflammatory factors IFN-γ and TNF-α; figure 1 As shown in C, Western Blot detected the high expression of Chi3l1 in the supernatant of hUC-MSCs stimulated by IFN-γ and TNF-α; figure 1 As shown in D, Western Blot dete...

Embodiment 2

[0031] Example 2 lentiviral vector transfection of hUC-MSCs

[0032] The sh-Chi3l1 vector was constructed by using lentivirus to infect hUC-MSCs, and the stably expressed sh-Chi3l1-hUC-MSCs were obtained, and the vector was GV493. A total of 3 lentiviral vectors were constructed, and the 75488 with the highest knockdown efficiency was selected for subsequent experiments.

[0033] Chi3l1-RNAi (75488) ACCCACATCATCTACAGCTTT Chi3l1-RNAi (75489) CAGCAGCTATGACATTGCCAA Chi3l1-RNAi (75490) AGGTGCAGTACCTGAAGGACA

[0034] The recovered hUC-MSCs P2 generation cells were inoculated into six-well plates, and the number of inoculated cells was 1×10 5 . Replace the medium with 10% FBS α-MEM complete medium containing 4 μl / ml HiTransGA, add virus suspension (titer is MOI=10, transfection virus amount is 1×10 7 24h after transfection, replace the medium with 2ml α-MEM complete medium containing 10% FBS, and carry out amplification culture, add puromycin (2μmol / ...

Embodiment 3

[0035] Example 3 co-culture of sh-Chi3l1-hUC-MSCs and T cells

[0036]hUC-MSCs, sh-Chi3l1-hUC-MSCs, sh-NC-hUC-MSCs were co-cultured with mouse T lymphocytes, and T cells were activated by anti-CD3. CFSE dyes were used to label the two groups of lymphocytes, and flow cytometry Cytometry detection of T cell proliferation:

[0037] a) separating T lymphocytes with mouse spleen lymphocyte separation liquid;

[0038] b) The anti-CD3 antibody was diluted with PBS to 1 μg / ml, added to a 96-well plate (50 μl / well), transferred to 37°C and incubated for 2 hours;

[0039] c) Discard the coating solution of the 96-well plate, wash twice with PBS, and add CFSE-stained T lymphocytes (2.5×10 4 / well), while adding hUC-MSCs, sh-Chi3l1-hUC-MSCs, sh-NC-hUC-MSCs respectively, and co-cultured for 72h;

[0040] d) Collecting the co-cultured T lymphocytes, and detecting the proliferation ratio and cell subsets of T lymphocytes by flow cytometry.

[0041] e) Total RNA of T cells after co-cult...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of Chi3l1 in regulation and control of immune regulation effect of human umbilical cord mesenchymal stem cells, wherein the immune regulation effect is to inhibit Th17 cell differentiation. By use of the transcriptome data of mesenchymal stem cells derived from early-stage human bone marrow, amnion, placenta and umbilical cord, bioinformatics analysis finds that the umbilical cord mesenchymal stem cells highly express Chi3l1 and are subjected to regulatory expression by main inflammatory factors IFN-[gamma] and TNF-[alpha]. An in-vitro human umbilical cord mesenchymal stem cell and T cell co-culture experiment finds that Chi3l1 can regulate and control the Th17 cell differentiation inhibition effect of the human umbilical cord mesenchymal stem cells, after Chi3l1 is knocked down, a Th17 cell differentiation inhibition capacity is reduced, meanwhile, p-STAT3 expression of CD4 cells is increased, and after a p-STAT3 inhibitor (S3I-201) is added, the Th17 differentiation inhibition capacity of hUC-MSCs is recovered.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to research on the mechanism of immune regulation of mesenchymal stem cells. Background technique [0002] Human umbilical cord derived mesenchymal stem cells (hUC-MSCs) are a kind of mesenchymal stem cells present in umbilical cord Wharton's jelly and perivascular tissue, which have the ability to adipocytes, osteoblasts, chondrocytes Differentiated multilineage potential and powerful immunomodulatory effects. Because hUC-MSCs are convenient to obtain materials, there are no moral and ethical disputes, the number of cells that can be obtained is large, the proliferation ability is strong, the immune regulation effect is strong, and there are many types of cell growth factors secreted, which is convenient for expansion and passage, and there is no matching, rejection, etc. It has become an ideal source of MSCs for clinical research and application. Compared with classical bone marrow ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C12N15/867C12N5/10C12N5/0783C12N5/0775
CPCC07K14/47C12N15/86C12N5/0668C12N5/0637C12N2510/00C12N2740/15043C12N2501/24C12N2501/25Y02A50/30
Inventor 张毅刘伟江白海涛袁福临刘元林李雪王洋
Owner ACADEMY OF MILITARY MEDICAL SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More