Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Bovine rotavirus recombinant VP8 protein and application

A bovine rotavirus and recombinant protein technology, applied in the fields of molecular biology and genetic engineering, can solve the problems of inability to reduce the incidence of virus transmission and high risk of intussusception, achieve good commercial development prospects, improve immune efficacy, The effect of easy purification preparation

Pending Publication Date: 2021-12-31
SOUTHWEST UNIVERSITY FOR NATIONALITIES
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there is no specific drug for the treatment of rotavirus. It is generally prevented by improving environmental sanitation and providing clean water sources, but relying on the above methods alone cannot reduce the incidence rate and prevent the spread of the virus
And the rotavirus vaccines that have been on the market are all attenuated live vaccines, which have a high risk of intussusception. Therefore, a more safe and effective bovine rotavirus that can avoid the risk of virulence rejuvenation and loose virus has been developed. Subunit vaccines are important

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bovine rotavirus recombinant VP8 protein and application
  • Bovine rotavirus recombinant VP8 protein and application
  • Bovine rotavirus recombinant VP8 protein and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] A method for preparing cow rotavirus recombinant VP8 gene protein, comprising the following steps:

[0037] (1) Amplification of BRV G6P[1]VP8 gene: The molecular epidemiological survey of dairy cows in some areas of my country and yak rotavirus in the Qinghai-Tibet Plateau region showed that SDA2 rotavirus was the dominant genotype of bovine rotavirus . Take an appropriate amount of bovine rotavirus P[1] strain virus nucleic acid-positive fecal samples stored in the Animal Medicine Laboratory of Southwest University for Nationalities, extract total RNA according to conventional methods, reverse-transcribe and synthesize cDNA, and conduct RT-PCR amplification. Primers: F: GATGACACCATATGGAGCCTATCCTGGACG; R: GACACCTCGAGCTGGATCGGCGGCAGGCC. Using biological software to splicing the gene fragments, a complete ORF sequence of VP8 gene was obtained, the size was 501bp, and its amino acid sequence was shown in SEQ ID NO: 1, encoding 170 amino acids, and its nucleic acid sequenc...

Embodiment 2

[0044] Preparation of rotavirus recombinant VP8 protein subunit vaccine

[0045] (1) After taking the purified recombinant VP8 protein in Example 1 and diluting it to 1 mg / mL, it was heated to 31° C. in a water bath with 201 adjuvant simultaneously. After the vaccine was placed at 4°C overnight, the quality of the vaccine was tested.

[0046] (2) Sterility test: The VP8 recombinant protein subunit vaccine was spread on LB medium, and no bacteria grew after culturing at 37°C for 24 hours.

[0047] (3) Dosage form detection; a small amount of VP8 subunit vaccine was dropped into deionized water, the vaccine was evenly mixed with deionized water, and the vaccine was a water-in-oil-in-water recombinant protein subunit vaccine.

[0048] (4) Preliminary stability test: Pipet 1 mL of vaccine into a 1.5 mL centrifuge tube, and centrifuge at 3000 r / min and 4°C for 15 min. The vaccine has no stratification.

[0049] (5) Safety test (animal inoculation method): The VP8 recombinant prot...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a bovine rotavirus recombinant VP8 protein and application. The amino acid sequence of the bovine rotavirus recombinant VP8 protein disclosed by the invention is as shown in SEQ ID NO. 1. The recombinant VP8 protein has good antigenicity and immunogenicity and can be efficiently expressed in a prokaryotic system, and the subunit vaccine can generate a relatively high-level neutralizing antibody and is suitable for being used as a rotavirus subunit vaccine.

Description

technical field [0001] The invention relates to the fields of molecular biology and genetic engineering, in particular to a bovine rotavirus recombinant VP8 protein and application. Background technique [0002] Group A rotavirus (RVA) is a zoonotic virus and an important pathogen causing acute diarrhea in children and young animals worldwide. Bovine rotavirus (BRV) can be transmitted through the fecal-oral route and the respiratory route, causing huge economic losses to the cattle industry all over the world. The detection rate was 21.4% to 90.91%. RV VP4 determines the P genotype of rotavirus. So far, 51 P-types have been found, and 14 P-types have been confirmed in BRVA. The P[1], P[5], and P[11] genotypes are the most common in BRVA. P-types detected in Chinese cattle herds include P[1], P[5], P[7], and P[11], among which G6P[1] type BRVA is widely prevalent in Chinese cattle herds. From 2019 to 2020, some scholars have also confirmed that the yak-derived BRV in the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/14C12N15/46C12N15/70A61K39/15A61P31/14A61P1/12
CPCC07K14/005C12N15/70A61K39/12A61P31/14A61P1/12C12N2720/12322C12N2720/12351C12N2800/22C12N2720/12334A61K2039/552
Inventor 汤承岳华王远微姜晓明
Owner SOUTHWEST UNIVERSITY FOR NATIONALITIES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com