5-aminolevulinic acid producing strain and construction method thereof
A technology of aminolevulinic acid and construction method, applied in the field of 5-aminolevulinic acid producing bacteria and construction thereof, can solve the problems to be further improved and the like, and achieve the effects of reducing production cost and improving output
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1: Codon optimization
[0042] The nucleotide sequence of the hemO gene obtained by the inventor from the existing database is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.2. The nucleotide sequence of the rhtA gene is shown in SEQ ID NO.3. The nucleotide sequence of the hemF gene is shown in SEQ ID NO.4.
[0043] In order to make hemO gene, hemF gene and rhtA gene more suitable for prokaryotic expression system, the present invention has carried out codon optimization on the nucleotide sequence composition of the above-mentioned genes respectively.
[0044] The nucleotide sequence of the hemO gene after codon optimization is shown in SEQ ID NO.6; the codon relative fitness figure before optimization is shown in figure 2 Shown; the codon relative fitness map after optimization is shown in image 3 shown.
[0045] The nucleotide sequence of the rhtA gene after codon optimization is shown in SEQ ID NO.7; the c...
Embodiment 2
[0048] Embodiment 2: the construction of Bacillus subtilis engineering bacteria
[0049] Red homologous recombination technology was used to knock out the pxpR, PoxB, ptsG, sucC, sucD and pta genes in Bacillus subtilis to obtain Bacillus subtilis engineering bacteria (Bacillus subtilisΔpxpRΔPoxBΔptsGΔsucCΔsucDΔpta); the specific process is as follows:
[0050] 1) Construction of the linear target box:
[0051] The knockout plasmid selects pK18mobSacB, which has kanamycin resistance; the homology arm of PoxB and ptsG is 40bp, the homology arm of pta and sucC&D is 35bp, and the homology arm of pxpR is 35bp;
[0052] The homology arm primers corresponding to the knockout of different genes are as follows:
[0053] Pk-pxpR-F: AGATGGAATGGCTGACATAGCAAAGGGGATGAATG; (SEQ ID NO. 9)
[0054] Pk-pxp-R: GTAGCCAATCTTTTCTCTGCTGCGTACATTAACGT. (SEQ ID NO.10)
[0055] Pk-poxB-F: TCTCCTGTGGTATTGAAAAAAGGAAAAAGGAGGATACGTT; (SEQ ID NO. 11)
[0056] Pk-poxB-R: AAAAAACAGGGGCCCTAAGAGCCTTGTTTTTTT...
Embodiment 3
[0086] Embodiment 3: Construction of the first recombinant expression vector
[0087] The plasmid pHT43-J was digested with AatⅡ and SmaⅠ, and the codon-optimized hemO gene (shown in SEQ ID NO.6) was integrated into the plasmid pHT43-J after double restriction digestion to obtain the recombinant plasmid pHT43-J -hemO, then digest the recombinant plasmid pHT43-J-hemO with XbaI and BamHI, and integrate the codon-optimized rhtA gene (shown in SEQ ID NO.7) into the recombinant plasmid pHT43-J- On hemO, obtain the first recombinant expression vector (pHT43-J-hemO-rhtA);
[0088] The constructed first recombinant expression vector was digested with four enzymes AatII, SmaI, XbaI and BamHI to verify the results as follows: Figure 9 shown. The results showed that the hemO gene (shown in SEQ ID NO.6) and the rhtA gene (shown in SEQ ID NO.7) had been successfully integrated into the plasmid pHT43-J.
PUM
| Property | Measurement | Unit |
|---|---|---|
| Wavelength | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More