Glu/Leu/Phe/Val dehydrogenase mutant and application thereof in preparation of L-glufosinate

A dehydrogenase and mutant technology, applied in the field of preparation of L-glufosinate-ammonium, can solve the problems of expensive, waste of raw materials, etc.

Pending Publication Date: 2022-01-25
YONGNONG BIOSCI +2
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It mainly includes the following two categories: (1) The derivatives of L-glufosinate-ammonium are used as substrates and obtained by direct enzymatic hydrolysis. The main advantages are high conversion rate and high ee value of the product, but expensive and unavailable hand (2) The precursor of racemic glufosinate-ammonium is used as a substrate, which is obtained by selective resolution of enzymes. The main advantages are that the raw materials are relatively easy to obtain and the catalyst activity is high, but the theoretical yield can only reach 50%, resulting in waste of raw materials

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Glu/Leu/Phe/Val dehydrogenase mutant and application thereof in preparation of L-glufosinate
  • Glu/Leu/Phe/Val dehydrogenase mutant and application thereof in preparation of L-glufosinate
  • Glu/Leu/Phe/Val dehydrogenase mutant and application thereof in preparation of L-glufosinate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0089] Embodiment 1: the construction of genetically engineered bacteria

[0090] The gene sequence of D-amino acid oxidase (DAAO, GenBank number: FMSP01000004.1, amino acid sequence shown in SEQ ID NO.1, nucleotide sequence shown in SEQ ID NO.6) derived from Microbotryum intermedium After gene synthesis, the expression plasmid pET-28a(+) was inserted to obtain pET-28a-daao. After sequencing verification, pET-28a-daao was transferred into the expression host E. coli BL21 (DE3) for subsequent expression of the recombinase.

[0091] The sequence of formic acid dehydrogenation (FDH) derived from Lactobacillus buchneri (the amino acid sequence is shown in SEQ ID NO.2, and the nucleotide sequence is shown in SEQ ID NO.7) was inserted into the expression plasmid pET-28a after the whole gene synthesis (+) pET-28a-fdh was obtained. After sequencing verification, pET-28a-fdh was transferred into the expression host E. coli BL21 (DE3) for subsequent expression of the recombinase.

[...

Embodiment 2

[0095] Embodiment 2: the cultivation of engineering bacterium thalline

[0096] The engineered bacteria recombinant Escherichia coli E.coli BL21(DE3) / pET-28a-DAAO, E.coli BL21(DE3) / pET-28a-LAADH, E.coli BL21(DE3) / pET-28a-FDH, E.coli BL21(DE3) / pET-28a-FDH, E. After .coli BL21(DE3) / pET-28a-GDH and E.coli BL21(DE3) / pET-28a-ADH were activated by streaking on the plate, pick a single colony and inoculate it into 10mL LB liquid containing 50μg / mL kanamycin In culture medium, shake culture at 37°C for 10 h. Transfer 2% of the inoculum into 50 mL of LB liquid medium also containing 50 μg / mL kanamycin, culture with shaking at 37 °C until the OD600 reaches about 0.8, add IPTG with a final concentration of 0.1 mM, and shake at 25 °C Cultivate for 12h. After the cultivation, the culture solution was centrifuged at 8000rpm for 10min, the supernatant was discarded, the bacteria were collected, and stored in a -80°C ultra-low temperature refrigerator until use.

Embodiment 3

[0097] Embodiment 3: Construction of D-amino acid oxidase (DAAO) mutant (position 62, position 226)

[0098] On the basis of the wild-type DAAO sequence described in Example 1, the 62nd and / or 226th positions (specifically F62K, M226T) were mutated. The primer sequences of PCR were designed for the mutated mutants at the 62nd and 226th positions of the mutated D-amino acid oxidase sequence, specifically as shown in Table 1:

[0099] Table 1

[0100] serial number Primer name Primer sequence 1 F62KF gattcttgcgggtccaccttggggcaccagttcgctc 2 F62KR gagcgaactggtgccccaaggtggacccgcaagaatc 3 M226TF ggggtctgacgcatcggtagtgcacagcttgac 4 M226TR gtcaagctgtgcactaccgatgcgtcagacccc

[0101] The PCR (25μL) amplification system is as follows:

[0102] Pfu buffer 12.5 μL, primer 2 μL, template plasmid 1 μL, dNTP 0.5 μL, Pfu 1 μL, add ddH 2 O to make up to 25 μL.

[0103] PCR amplification conditions:

[0104] (1) Pre-denaturation at 95°C for ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a Glu / Leu / Phe / Val dehydrogenase mutant and application thereof in preparation of L-glufosinate. When the Glu / Leu / Phe / Val dehydrogenase mutant is compared with an amino acid sequence of Glu / Leu / Phe / Val dehydrogenase containing a sequence shown in SEQ ID NO. 5, the amino acid sequence of the Glu / Leu / Phe / Val dehydrogenase mutant contains substitution of amino acid residues corresponding to the 91 position and / or the 168 position, the 91 position and the 168 position are defined by reference to the SEQ ID NO. 5, and the amino acid sequence of the Glu / Leu / Phe / Val dehydrogenase mutant and the sequence shown in the SEQ ID NO. 5 have at least 90% of identity.

Description

technical field [0001] The application relates to the field of biotechnology; in particular, the application relates to a Glu / Leu / Phe / Val dehydrogenase mutant, and the use of the Glu / Leu / Phe / Val dehydrogenase mutant in the preparation of L-glufosinate-ammonium , and a method for preparing L-glufosinate-ammonium by using the Glu / Leu / Phe / Val dehydrogenase mutant. Background technique [0002] Glufosinate-ammonium (also known as bialaphos, glufosinate, trade names include Baoshida, Baisuton, etc., English name is phosphinothricin (abbreviated as PPT), chemical name is 2-amino-4-[hydroxyl (methyl ) Phosphono] butyric acid) is a low-toxic, high-efficiency, non-selective contact-killing organophosphorus herbicide developed in the 1980s by the German company Hearst (now belonging to Bayer). Glufosinate-ammonium can inhibit glutamine synthetase after acting on plants, thereby interrupting the reversible reaction of glutamic acid in plants, causing metabolic disorders, causing plant...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/06C12N15/53C12N15/70C12N1/21C12P41/00C12P13/04
CPCC12N9/0016C12N15/70C12P41/002C12P13/04C12Y104/01005
Inventor 王华磊魏东芝吴承骏刘清海张舰罗中华张长雷
Owner YONGNONG BIOSCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap