Brassica napus BnHBBD gene site-specific mutagenesis method and application
A technology of gene-directed mutagenesis and Brassica napus, which is applied in the field of plant gene editing and plant breeding, can solve the problems of short flowering period suitable for ornamental viewing, low harvesting efficiency, and easy cracking of siliques, so as to shorten the acquisition period, reduce losses, and not easily Shedding effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0062] Embodiment 1: Identification and acquisition of BnHBBD gene
[0063] In Brassica napus, HBBD has 5 members. The present invention uses transcriptome data and bioinformatics analysis to obtain 2 HBBD genes with the highest expression and highest homology through evolutionary tree and homology comparison— —BnHBBD-A07 and BnHBBD-C06, due to the high similarity of these two genes, there is only a few base differences, which are difficult to distinguish by ordinary PCR methods. In this example, the sequencing method is used to distinguish BnHBBD-A07 and BnHBBD-C06.
[0064] According to the coding sequence design primer of the BnHBBD gene on the rape website (https: / / www.genoscope.cns.fr / brassicanapus / ), the primer sequence is:
[0065] HBBD-F (SEQ.ID.NO.13):ATGGCTCCGTGTCGTACG
[0066] HBBD-R (SEQ.ID.NO.14): TCAATGAGGATGAGAGTC;
[0067] Then, using the leaf DNA of rapeseed variety Y127 (from Huazhong Agricultural University) as a template, the CDS sequence of the BnHBBD g...
Embodiment 2
[0080] Example 2: Construction of BnHBBD-A07 and BnHBBD-C06 editing vectors for directed mutation of Brassica napus genes based on CRISPR / Cas9 system
[0081] Submit the BnHBBD-A07 and BnHBBD-C06 gene sequences to the website http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR, screen the target sites, and select the target sites Target1 and Target2. The Target1 sequence is: 5 '-TACGATGGTTCTGCTCTGTC-3'(SEQ.ID.NO.1), Target2 sequence is 5'-TGCAAGAATTGGAGCCACCG-3'(SEQ.ID.NO.2), connect the above two target sequences to two identical The 5' end of the sgRNA sequence: [(20bptarget)GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAAGTCCGTT ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT](SEQ.ID.NO.3), where (20bp target) is the length of Target1 and Target2, making the double-target gene editing vector pKSE401- BnHBBD-CRISPR can knock out the target sequence twice to ensure effective editing.
[0082] Design CRISPR / Cas9 vector target primers according to the screened targets, and the primer sequences are shown in T...
Embodiment 3
[0096] Example 3: Transformation of Brassica napus (Brassicanapus) with pKSE401-BnHBBD-CRISPR gene editing recombinant vector
[0097] A. Sowing:
[0098] In order to quickly obtain the required new germplasm of rapeseed, select Brassica napus Y127 seeds that can grow quickly without vernalization (the seeds are from teacher Hong Dengfeng of Huazhong Agricultural University), put them in a 10mL centrifuge tube, and add alcohol with a volume fraction of 75% , turn it upside down, soak for 1min, absorb alcohol with a pipette, add an appropriate amount of sterile water to rinse 3-5 times; then add 15% bleach solution (8.115mL sterile water + 1.875mL sodium hypochlorite + 10μL triton), Turn the centrifuge tube upside down and soak the seeds for 6 minutes. The time for alcohol disinfection and sterilization of heavily polluted seeds can be extended appropriately, but too long time will affect the germination of the seeds. Then suck off the disinfectant, add an appropriate amount o...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


