Brassica napus BnHBBD gene site-specific mutagenesis method and application

A technology of gene-directed mutagenesis and Brassica napus, which is applied in the field of plant gene editing and plant breeding, can solve the problems of short flowering period suitable for ornamental viewing, low harvesting efficiency, and easy cracking of siliques, so as to shorten the acquisition period, reduce losses, and not easily Shedding effect

Pending Publication Date: 2022-01-28
JIANGSU UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, rapeseed also has problems such as easy cracking of siliques, large loss of rapeseed caused by mechanized harvesting, low harvesting efficiency, and short flowering period suitable for viewing.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Brassica napus BnHBBD gene site-specific mutagenesis method and application
  • Brassica napus BnHBBD gene site-specific mutagenesis method and application
  • Brassica napus BnHBBD gene site-specific mutagenesis method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Embodiment 1: Identification and acquisition of BnHBBD gene

[0063] In Brassica napus, HBBD has 5 members. The present invention uses transcriptome data and bioinformatics analysis to obtain 2 HBBD genes with the highest expression and highest homology through evolutionary tree and homology comparison— —BnHBBD-A07 and BnHBBD-C06, due to the high similarity of these two genes, there is only a few base differences, which are difficult to distinguish by ordinary PCR methods. In this example, the sequencing method is used to distinguish BnHBBD-A07 and BnHBBD-C06.

[0064] According to the coding sequence design primer of the BnHBBD gene on the rape website (https: / / www.genoscope.cns.fr / brassicanapus / ), the primer sequence is:

[0065] HBBD-F (SEQ.ID.NO.13):ATGGCTCCGTGTCGTACG

[0066] HBBD-R (SEQ.ID.NO.14): TCAATGAGGATGAGAGTC;

[0067] Then, using the leaf DNA of rapeseed variety Y127 (from Huazhong Agricultural University) as a template, the CDS sequence of the BnHBBD g...

Embodiment 2

[0080] Example 2: Construction of BnHBBD-A07 and BnHBBD-C06 editing vectors for directed mutation of Brassica napus genes based on CRISPR / Cas9 system

[0081] Submit the BnHBBD-A07 and BnHBBD-C06 gene sequences to the website http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR, screen the target sites, and select the target sites Target1 and Target2. The Target1 sequence is: 5 '-TACGATGGTTCTGCTCTGTC-3'(SEQ.ID.NO.1), Target2 sequence is 5'-TGCAAGAATTGGAGCCACCG-3'(SEQ.ID.NO.2), connect the above two target sequences to two identical The 5' end of the sgRNA sequence: [(20bptarget)GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAAGTCCGTT ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT](SEQ.ID.NO.3), where (20bp target) is the length of Target1 and Target2, making the double-target gene editing vector pKSE401- BnHBBD-CRISPR can knock out the target sequence twice to ensure effective editing.

[0082] Design CRISPR / Cas9 vector target primers according to the screened targets, and the primer sequences are shown in T...

Embodiment 3

[0096] Example 3: Transformation of Brassica napus (Brassicanapus) with pKSE401-BnHBBD-CRISPR gene editing recombinant vector

[0097] A. Sowing:

[0098] In order to quickly obtain the required new germplasm of rapeseed, select Brassica napus Y127 seeds that can grow quickly without vernalization (the seeds are from teacher Hong Dengfeng of Huazhong Agricultural University), put them in a 10mL centrifuge tube, and add alcohol with a volume fraction of 75% , turn it upside down, soak for 1min, absorb alcohol with a pipette, add an appropriate amount of sterile water to rinse 3-5 times; then add 15% bleach solution (8.115mL sterile water + 1.875mL sodium hypochlorite + 10μL triton), Turn the centrifuge tube upside down and soak the seeds for 6 minutes. The time for alcohol disinfection and sterilization of heavily polluted seeds can be extended appropriately, but too long time will affect the germination of the seeds. Then suck off the disinfectant, add an appropriate amount o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a brassica napus BnHBBD gene site-specific mutagenesis method and application, and belongs to the technical field of plant gene editing and plant breeding. According to the invention, target spots Target1 and Target2 are designed and screened according to the BnHBBD gene in the brassica napus, sgRNA sequences are designed, then the two target spots are respectively connected with two same sgRNA sequences, a double-target-spot gene editing vector pKSE401-BnHBBD-CRISPR is constructed, the brassica napus is converted, site-directed mutagenesis of the BnHBBD gene of the brassica napus is realized, the exogenous gene carried by the vector is separated through selfing to obtain a new non-transgenic rape material which is long in flowering period, resistant to sclerotiniose and not easy to crack in silique. According to the invention, the gene editing technology is utilized to edit in the brassica napus, so that the obtaining period of new germplasm is greatly shortened, and innovative germplasm is provided for breeding of the brassica napus.

Description

technical field [0001] The invention belongs to the technical field of plant gene editing and plant breeding, and in particular relates to a method and application of site-directed mutation of BnHBBD gene of Brassica napus. Background technique [0002] Rapeseed (Brassica napus L.) is one of the most widely planted oil crops in my country. It can not only be used to produce edible oil, but also can be used for ornamental purposes. It is one of the important economic crops in my country. Biological breeding and seed engineering are developing rapidly. At present, my country's breeding methods and technologies pay more attention to biological breeding, and will soon set up key special projects for the excavation and innovative utilization of agricultural biological germplasm resources to enhance innovation capabilities and improve the level of independent research and development. [0003] In modern society, with the improvement of people's living standards, rapeseed has brigh...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/55C12N9/22C12N15/82C12N1/21C12N15/29C07K14/415A01H5/00A01H5/02A01H6/20
CPCC12N15/113C12N9/22C07K14/415C12N15/8218C12N15/827C12N15/8261C12N15/8282C12N2800/22C12N2310/20
Inventor谭小力耿瑞朱克明王政丁丽娜曹军李玉龙薛怡萱单悦李雷
OwnerJIANGSU UNIV