Method for identifying RV infection and virus genotype and application thereof
A virus gene and genotype technology, applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve the problem of inaccurate genotype identification, non-contamination, specificity and sensitivity in the process of adding samples Poor performance and other problems, to achieve the effect of short detection cycle, accurate identification, simple operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0075] A method for distinguishing RV infection and identifying virus genotype
[0076] 1. Primer design:
[0077] The RV VP4 gene sequence was downloaded from NCBI, mainly including the rotavirus VP4 gene isolated or detected from humans, pigs and monkeys; sequence alignment analysis was performed by Megalign. The reverse transcription primer ConRev R was designed based on the conserved motif (nt802-806: ATGCA) and the anchor primer (GGCCACGCGTCGACTAGTACTAT).
[0078] Anchor primer design Reverse transcription primer ConRev R is as follows;
[0079]
[0080] 2. Viral nucleic acid extraction:
[0081] Take 200 μL of anal swab PBS supernatant, centrifuge at 4°C, 2000r / min for 10 minutes, take the supernatant, and extract viral RNA with a viral genome DNA / RNA extraction kit;
[0082] 3. Reverse transcription of viral nucleic acid:
[0083] Take 4.5 μL of the extracted RNA, 0.5 μL of ConRev R (50 μM) and mix well, then incubate at 65°C for 5 minutes, then immediately bathe...
Embodiment 2
[0090] Establishment of a method for amplifying the nt11-806 region of VP4
[0091] cDNA was prepared as a template after RNA extraction from the viral supernatant. The annealing temperature of the first round of PCR was set at 50°C, and the number of cycles was set at 35. Two different bands were observed after PCR products were separated by agarose gel electrophoresis. Such as figure 1 As shown, bands were amplified at 750bp-1000bp and 500bp-750bp, respectively.
[0092] According to the size of the target fragment (≈800bp), the band at 750bp-1000bp was gel-cut and recovered, and then the second round of PCR was performed. The annealing temperature of the second round of PCR was set at 55°C, and the number of cycles was set at 35. After the PCR product was separated by agarose gel electrophoresis, the target band was amplified at 750bp ~ 1000bp, such as figure 2 shown. The bands were gel-cut and recovered for sequencing.
[0093] It was confirmed by Blast that the ge...
Embodiment 3
[0095] Specific and Sensitive Assays
[0096] Using different porcine enterovirus RNAs as templates, the specificity of the method was verified under the same conditions. The result is as image 3 As shown, the G9P[23] NMTL strain can amplify the target band at 750bp-1000bp, while other viruses do not appear amplified bands.
[0097] The template was prepared from the 10-fold diluted virus supernatant, and its sensitivity was identified by this method. The result is as Figure 4 As shown, the established method has a detection limit of 10 2 TCID 50 , indicating that the method is highly sensitive.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More