Unlock instant, AI-driven research and patent intelligence for your innovation.

Porcine pseudorabies virus gI/gE double-gene-deleted strain and application thereof

A technology of porcine pseudorabies virus and pseudorabies virus, applied in the direction of virus/bacteriophage, virus, virus peptide, etc., can solve the problems of use restriction, slow drug release, antibacterial drug residue, etc., and achieve good safety, easy operation, good Immunogenic effects

Pending Publication Date: 2022-02-15
BEIJING KEMUFENG BIOLOGICAL PHARMA +3
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the most commonly used treatments for porcine pseudorabies are traditional Chinese medicine, antiviral western medicine, antibacterial medicine, and immune vaccine. Traditional Chinese medicine is unreasonable in its composition or simply crushed, and its particle size is too large, and the drug release is slow, resulting in its bioavailability. The clinical effect is not ideal; antibacterial drugs are strictly restricted due to drug residues and drug resistance; and various antiviral drugs such as ribavirin and amantadine have been banned by the Ministry of Agriculture; Therefore, immunization vaccine has become the main means to prevent porcine pseudorabies
However, with the continuous mutation of the virus, the traditional porcine pseudorabies vaccine strains currently on the market can no longer protect against the attack of porcine pseudorabies mutant strains.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Porcine pseudorabies virus gI/gE double-gene-deleted strain and application thereof
  • Porcine pseudorabies virus gI/gE double-gene-deleted strain and application thereof
  • Porcine pseudorabies virus gI/gE double-gene-deleted strain and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 Isolation and Identification of Porcine Pseudorabies Virus Epidemic Variation and Virus Strain (PRV-E6)

[0048]The PRV-gE gene detection was carried out on the suspected pseudorabies pigs collected from Heilongjiang, Henan and Shanxi by conventional PCR method, and the positive disease materials were ground and filtered, and then inoculated with BHK-21 cells for virus isolation. , A total of 3 strains of PRV virus were obtained, named as PRV-HLJ2012, PRV-SX2012 and PRV-HN2012 respectively.

[0049] The PRV-SX2012 strain with higher virus proliferation titer was further subcloned on BHK-21 cells, and a cloned strain was screened and named PRV-E6. The results of the molecular epidemiological survey of the gB, gC, gE and TK genes of the cloned strain showed that PRV-E6 had the evolutionary characteristics of the new mutant strains that appeared in my country in 2011-2012. The results of the toxicity test also showed that the PRV-E6 strain was treated with 2mL×1...

Embodiment 2

[0050] Example 2 Porcine pseudorabies virus gI / gE double gene deletion strain (PRV-E6-△gE / gI strain) construction

[0051] sgRNA sequence design and recombinant vector construction

[0052] Referring to the complete PRV genome sequence published in GenBank, design and synthesize sgRNAs with the following sequence structures, which are respectively denoted as gI sgRNA1 and gE sgRNA2:

[0053] gI sgRNA1-F: accgcctcctcgccgccctgaccctgg;

[0054] gI sgRNA1-R: aaacccagggtcagggcggcgaggagg;

[0055] gE sgRNA2-F: accgcctcaacggcgacgaccgccgcg;

[0056] gE sgRNA2-R: aaaccgcggcggtcgtcgccgttgagg.

[0057] Targeting plasmid construction

[0058] Through routine annealing and phosphorylation modification, the strain was inserted into the BbsI restriction site of the gI sgRNA1 and gE sgRNA2 vectors (see figure 1 ), constructed as a targeting plasmid.

[0059] Plasmid digestion, the reaction system includes:

[0060] psgRNA plasmid 1 μg;

[0061] BbsI 1 μL;

[0062] 10X Buffer 2.2μL

...

Embodiment 3

[0085] Example 3 Gene identification of PRV-E6-△gE / gI strain

[0086] gI / gE gene PCR identification

[0087] The cell culture was inoculated with BHK-21 monolayer cells, and when obvious lesions appeared, the cell supernatant was harvested. Take out 50 μl and dilute to 200 μl, extract DNA for PCR identification.

[0088] The primer sequences for PCR identification were designed as follows:

[0089] F: 5'-gcgtgtgcgtctacatcttct-3';

[0090] R: 5'-ggtatttaagcggggcgggcat-3'.

[0091] PCR reaction system (50 μl): 2×GC buffer 25 μl, dNTP Mixture 5 μl, upstream and downstream primers 2 μl each, Prime star 0.5 μl, DNA template 2 μl, H 2 O 13.5 μl.

[0092] PCR reaction conditions: pre-denaturation at 94°C for 1 minute; denaturation at 98°C for 10 seconds, annealing at 56°C for 15 seconds, extension at 72°C for 3 seconds, a total of 35 cycles; extension at 72°C for 5 minutes.

[0093] After the co-transformation of the cell culture, after PCR identification, it was found that the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of virology genetic engineering and preventive veterinary medicine, particularly relates to a gI / gE double-gene-deleted strain of a porcine pseudorabies epidemic variation virus, and further discloses a construction method of the gI / gE double-gene-deleted strain and application of the gene-deleted strain. A female parent of the porcine pseudorabies virus gene-deleted strain PRV-E6-delta gE / gI is a wild epidemic variant strain PRV-E6 independently separated from a disease material, and on the basis of the variant strain PRV-E6, a unique and simplified one-step double-knockout technology is adopted to knock out gI / gE double-virulence genes, so the porcine pseudorabies virus gene-deleted strain PRV-E6-gE / gI is obtained. The gB, gC and TK genes of the strain have the same evolutionary characteristics as prevalent variant virulent strains newly appearing after 2012, and have the advantages of high proliferation titer and strong virulence (wherein a median lethal dose to mice is 10<3.3> TCID50, and the morbidity of 2-to-3-weeks-old piglets is 10<5> TCID50).

Description

technical field [0001] The invention belongs to the technical fields of virological genetic engineering technology and preventive veterinary medicine, and particularly relates to a gI / gE double gene deletion strain of porcine pseudorabies epidemic mutant virus, and further discloses its construction method and application of the gene deletion strain. Background technique [0002] Porcine pseudorabies is an important infectious disease caused by pseudorabies virus (PRV), characterized by fever, itching, encephalomyelitis, etc. It is one of the most serious infectious diseases currently endangering the pig industry. It is widely popular in the world and causes huge economic losses to the world's pig industry every year. Pseudorabies in pigs is widespread and serious in my country, and it is one of the main diseases restricting the production of large-scale pig farms. It can cause abortion, stillbirth or mummification in pregnant sows and neurological symptoms, paralysis and h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/01C12N15/113A61K39/245A61P31/22C12R1/93
CPCC12N7/00C07K14/005C12N15/1133A61K39/12A61P31/22C12N2710/16721C12N2710/16722C12N2710/16743C12N2710/16734C12N2310/20A61K2039/5252A61K2039/5254A61K2039/5256A61K2039/552
Inventor 陈义锋刘业兵石艳丽陈晓春陈硕刘耀宗聂思静闫国晖赵亚荣
Owner BEIJING KEMUFENG BIOLOGICAL PHARMA
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More