Porcine pseudorabies virus gI/gE double-gene-deleted strain and application thereof
A technology of porcine pseudorabies virus and pseudorabies virus, applied in the direction of virus/bacteriophage, virus, virus peptide, etc., can solve the problems of use restriction, slow drug release, antibacterial drug residue, etc., and achieve good safety, easy operation, good Immunogenic effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Example 1 Isolation and Identification of Porcine Pseudorabies Virus Epidemic Variation and Virus Strain (PRV-E6)
[0048]The PRV-gE gene detection was carried out on the suspected pseudorabies pigs collected from Heilongjiang, Henan and Shanxi by conventional PCR method, and the positive disease materials were ground and filtered, and then inoculated with BHK-21 cells for virus isolation. , A total of 3 strains of PRV virus were obtained, named as PRV-HLJ2012, PRV-SX2012 and PRV-HN2012 respectively.
[0049] The PRV-SX2012 strain with higher virus proliferation titer was further subcloned on BHK-21 cells, and a cloned strain was screened and named PRV-E6. The results of the molecular epidemiological survey of the gB, gC, gE and TK genes of the cloned strain showed that PRV-E6 had the evolutionary characteristics of the new mutant strains that appeared in my country in 2011-2012. The results of the toxicity test also showed that the PRV-E6 strain was treated with 2mL×1...
Embodiment 2
[0050] Example 2 Porcine pseudorabies virus gI / gE double gene deletion strain (PRV-E6-△gE / gI strain) construction
[0051] sgRNA sequence design and recombinant vector construction
[0052] Referring to the complete PRV genome sequence published in GenBank, design and synthesize sgRNAs with the following sequence structures, which are respectively denoted as gI sgRNA1 and gE sgRNA2:
[0053] gI sgRNA1-F: accgcctcctcgccgccctgaccctgg;
[0054] gI sgRNA1-R: aaacccagggtcagggcggcgaggagg;
[0055] gE sgRNA2-F: accgcctcaacggcgacgaccgccgcg;
[0056] gE sgRNA2-R: aaaccgcggcggtcgtcgccgttgagg.
[0057] Targeting plasmid construction
[0058] Through routine annealing and phosphorylation modification, the strain was inserted into the BbsI restriction site of the gI sgRNA1 and gE sgRNA2 vectors (see figure 1 ), constructed as a targeting plasmid.
[0059] Plasmid digestion, the reaction system includes:
[0060] psgRNA plasmid 1 μg;
[0061] BbsI 1 μL;
[0062] 10X Buffer 2.2μL
...
Embodiment 3
[0085] Example 3 Gene identification of PRV-E6-△gE / gI strain
[0086] gI / gE gene PCR identification
[0087] The cell culture was inoculated with BHK-21 monolayer cells, and when obvious lesions appeared, the cell supernatant was harvested. Take out 50 μl and dilute to 200 μl, extract DNA for PCR identification.
[0088] The primer sequences for PCR identification were designed as follows:
[0089] F: 5'-gcgtgtgcgtctacatcttct-3';
[0090] R: 5'-ggtatttaagcggggcgggcat-3'.
[0091] PCR reaction system (50 μl): 2×GC buffer 25 μl, dNTP Mixture 5 μl, upstream and downstream primers 2 μl each, Prime star 0.5 μl, DNA template 2 μl, H 2 O 13.5 μl.
[0092] PCR reaction conditions: pre-denaturation at 94°C for 1 minute; denaturation at 98°C for 10 seconds, annealing at 56°C for 15 seconds, extension at 72°C for 3 seconds, a total of 35 cycles; extension at 72°C for 5 minutes.
[0093] After the co-transformation of the cell culture, after PCR identification, it was found that the...
PUM
Login to view more Abstract
Description
Claims
Application Information
Login to view more - R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap