A combination of SNP molecular markers for detecting rapeseed varieties and its application
A molecular marker and variety technology, applied in applications, recombinant DNA technology, microbial determination/inspection, etc., can solve the problems of cumbersome operation, poor accuracy and stability, and high cost, and achieve good repeatability and stability. The effect of high resolution and high degree of automation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] Example 1 Screening and Primer Design of SNP Markers Related to the Purity of Rapeseed Varieties
[0069] 1. Screening of SNP molecular markers related to the purity of rape varieties
[0070] The present invention obtains a batch of candidate SNP markers by collecting high-quality SNP markers of Brassica napus from multiple sources and uses that have been verified by the laboratory, and according to the screening principle of stable amplification and uniform distribution of chromosomes. Screening process such as figure 1 shown.
[0071] The invention utilizes the sequence information of the SNP marker site to find the physical position of the SNP marker site on the Brassica napus reference genome (Brassica napus 4.0) on NCBI. These SNP sites were used to develop corresponding molecular markers, and the online primer design website BatchPrimer3 was used to design primers, and then 94 diverse materials of Brassica napus were selected for KASP reaction verification to d...
Embodiment 2
[0084] Example 2 KASP primer validation method for SNP molecular markers
[0085] 1. Genomic DNA extraction from test materials
[0086] Use the CTAB method to extract the DNA of the rapeseed seeds to be tested. The quantity and quality of the extracted DNA must meet the requirements of PCR amplification, that is, the DNA is not degraded, and the UV absorbance of the DNA solution is OD. 260 with OD 280 The ratio should be between 1.70 and 2.0, the concentration of DNA should be above 30ng / μL, and the total amount of DNA should be at least 2μg. After the extraction, the DNA of each seed should be uniformly diluted to 30ng / μL, and stored at 4°C for future use.
[0087] 2. Genotyping using KASP technology
[0088] Using the DNA in step 1 as a template, add each set of primer mixture and PCR master mix in the above SNP primer combination, and use the NEXAR system of the Array Tape genotyping platform to automatically assemble the PCR amplification system, and PCR amplification ...
Embodiment 319
[0098] Example 3 Application of 19 SNP marker sites KASP primer set in the authenticity detection of rapeseed varieties
[0099] 1. Test material
[0100] Randomly pick 96 rapeseed seeds to be tested and 1 seed of a standard sample for authenticity identification, and use the DNA extraction method in Example 2 to extract genomic DNA. And the genomic DNA of each seed was uniformly diluted to 30ng / μL, and stored at 4°C for future use.
[0101] Select the specific primer set of 19 SNP sites in Example 1 to detect, wherein the 5' ends of specific primer Primer_X and specific primer Primer_Y add sequence tag A and sequence tag B respectively:
[0102] Sequence tag A: GAAGGTGACCAAGTTCATGCT (SEQ ID NO.77);
[0103] Sequence tag B: GAAGGTCGGAGTCAACGGATT (SEQ ID NO. 78).
[0104] Sequence tag A and sequence tag B are suitable for KASP Master mix (PCR master mix) from LGC Company in the UK. After the primers are synthesized, dissolve the three primers to 100 μM with 10 mM Tris-HCl (p...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


