Unlock instant, AI-driven research and patent intelligence for your innovation.

A combination of SNP molecular markers for detecting rapeseed varieties and its application

A molecular marker and variety technology, applied in applications, recombinant DNA technology, microbial determination/inspection, etc., can solve the problems of cumbersome operation, poor accuracy and stability, and high cost, and achieve good repeatability and stability. The effect of high resolution and high degree of automation

Active Publication Date: 2022-04-19
HUAZHI RICE BIO TECH CO LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In related technologies, identification of varieties and purity of rapeseed materials mainly depends on: (1) Morphological identification, which usually adopts methods of field planting, observation statistics, and species test analysis, based on seedlings, plant types, roots, leaves, flowers, pollen The size, shape, color and other visible appearance of tissues or organs such as seeds and organs can be used to identify crop varieties, but its disadvantages are also obvious, and it is easily affected by the environment and cultivation conditions, and the accuracy and stability are poor.
(2) Identification of biochemical markers, such as isoenzyme and storage protein SDS-PAGE electrophoresis technology, is to analyze the difference in material and energy metabolism between male sterile and normal fertile plant anthers from the perspective of physiology and biochemical metabolism, and the experiment takes a long time. Detection specificity, sensitivity and resolution are low; data results from different testing laboratories are difficult to compare and verify with each other
(3) DNA molecular markers, including RFLP markers, RAPD markers, AFLP markers, and SSR markers. Among them, RAPD molecular markers are not sensitive to PCR reaction conditions and are not reliable enough, while RFLP and AFLP molecular markers are cumbersome and expensive to operate. The specificity is limited, but the automation and throughput of the SSR labeling detection method are low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A combination of SNP molecular markers for detecting rapeseed varieties and its application
  • A combination of SNP molecular markers for detecting rapeseed varieties and its application
  • A combination of SNP molecular markers for detecting rapeseed varieties and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Example 1 Screening and Primer Design of SNP Markers Related to the Purity of Rapeseed Varieties

[0069] 1. Screening of SNP molecular markers related to the purity of rape varieties

[0070] The present invention obtains a batch of candidate SNP markers by collecting high-quality SNP markers of Brassica napus from multiple sources and uses that have been verified by the laboratory, and according to the screening principle of stable amplification and uniform distribution of chromosomes. Screening process such as figure 1 shown.

[0071] The invention utilizes the sequence information of the SNP marker site to find the physical position of the SNP marker site on the Brassica napus reference genome (Brassica napus 4.0) on NCBI. These SNP sites were used to develop corresponding molecular markers, and the online primer design website BatchPrimer3 was used to design primers, and then 94 diverse materials of Brassica napus were selected for KASP reaction verification to d...

Embodiment 2

[0084] Example 2 KASP primer validation method for SNP molecular markers

[0085] 1. Genomic DNA extraction from test materials

[0086] Use the CTAB method to extract the DNA of the rapeseed seeds to be tested. The quantity and quality of the extracted DNA must meet the requirements of PCR amplification, that is, the DNA is not degraded, and the UV absorbance of the DNA solution is OD. 260 with OD 280 The ratio should be between 1.70 and 2.0, the concentration of DNA should be above 30ng / μL, and the total amount of DNA should be at least 2μg. After the extraction, the DNA of each seed should be uniformly diluted to 30ng / μL, and stored at 4°C for future use.

[0087] 2. Genotyping using KASP technology

[0088] Using the DNA in step 1 as a template, add each set of primer mixture and PCR master mix in the above SNP primer combination, and use the NEXAR system of the Array Tape genotyping platform to automatically assemble the PCR amplification system, and PCR amplification ...

Embodiment 319

[0098] Example 3 Application of 19 SNP marker sites KASP primer set in the authenticity detection of rapeseed varieties

[0099] 1. Test material

[0100] Randomly pick 96 rapeseed seeds to be tested and 1 seed of a standard sample for authenticity identification, and use the DNA extraction method in Example 2 to extract genomic DNA. And the genomic DNA of each seed was uniformly diluted to 30ng / μL, and stored at 4°C for future use.

[0101] Select the specific primer set of 19 SNP sites in Example 1 to detect, wherein the 5' ends of specific primer Primer_X and specific primer Primer_Y add sequence tag A and sequence tag B respectively:

[0102] Sequence tag A: GAAGGTGACCAAGTTCATGCT (SEQ ID NO.77);

[0103] Sequence tag B: GAAGGTCGGAGTCAACGGATT (SEQ ID NO. 78).

[0104] Sequence tag A and sequence tag B are suitable for KASP Master mix (PCR master mix) from LGC Company in the UK. After the primers are synthesized, dissolve the three primers to 100 μM with 10 mM Tris-HCl (p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a combination of SNP molecular markers for detecting rapeseed varieties and its application. The SNP molecular marker combination of the present invention is composed of 19 high-quality, single-copy and high polymorphic SNP molecular markers, numbered BNGPS1001.K1~BNGPS1019.K1, and the SNP molecular markers can be used for purity identification of different rapeseed varieties and genetic family groups, It has the advantages of high accuracy, good stability, low cost, simple operation, convenience and speed, etc., and has wide application prospects.

Description

technical field [0001] The invention relates to the field of rapeseed breeding, in particular to a combination of SNP molecular markers for detecting rapeseed varieties and its application. Background technique [0002] Rapeseed, a cruciferous crop, is the largest oil crop in China and one of the oil crops with the highest oil production efficiency. Authenticity and purity testing of rapeseed varieties has always been one of the most important techniques in quality management and variety development. In recent years, the variety of rapeseed on the market has been increasing, but in the seed market, homonyms and different names and homonyms and different names have occurred from time to time, and even some unqualified seeds have been mixed into the market, causing huge economic losses. Therefore, rapid and accurate identification of varieties plays an important role in identifying fake species and disputes over property rights. The heterosis of yield traits in rapeseed is s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11A01H1/04
CPCC12Q1/6895A01H1/04C12Q2600/156
Inventor 易丽媛彭佩田冰川唐顺学
Owner HUAZHI RICE BIO TECH CO LTD