Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction method and application of iris plant eleutherine eleutherine VIGS silencing system

A construction method, the technology of shallots, applied in the field of plant genetic engineering, can solve the problems of lack of construction, lack of gene sequence information, self-genetic transformation system, functional research and synthesis mechanism of effective active ingredients, etc.

Pending Publication Date: 2022-03-01
GUANGDONG ACAD OF FORESTRY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Although research on the chemical constituents and pharmacological activities of red onion has been carried out (Jiang et al., 2018; Xu Xiaomei et al., 2018), there are very few studies on its molecular biology, especially the lack of gene sequence information and its own genetic transformation. The system has not yet been constructed, resulting in a relatively lagging research on its gene expression analysis, functional research and synthesis mechanism of effective active ingredients

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of iris plant eleutherine eleutherine VIGS silencing system
  • Construction method and application of iris plant eleutherine eleutherine VIGS silencing system
  • Construction method and application of iris plant eleutherine eleutherine VIGS silencing system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030]Example 1: Establishment of shallot PDS gene VIGS system

[0031] 1. Method

[0032] (1) Strains

[0033] Escherichia coli DH5α competent cells (product specification CAT#: DL1001) and Agrobacterium GV3101 competent cells (product specification CAT#: AC1001) were purchased from Shanghai Weidi Biotechnology Co., Ltd.; pTRV1 vector (product number: BiovectorPTRV1), pTRV2 vector ( Item No.: BioVectorPTRV2) was purchased from Protin Biotechnology (Beijing) Co., Ltd.

[0034] (2) Reagents

[0035] RNA extraction kit: Beijing Huayueyang Ultrafast Plant RNA Extraction Kit; Reverse Transcription Kit: StarScript II cDNA First Strand Synthesis Premix Reagent (including degenome); DNA gel recovery kit: DiaSpin column DNA gel Recovery Kit; Plasmid Extraction Kit: SanPerp Column Plasmid DNA Small Extraction Reagent; Digestion and Ligation: ClonExpressII One Step Cloning Kit.

[0036] (3) Experimental process

[0037] ① In order to verify the feasibility of the VIGS system in stu...

Embodiment 2

[0068] Example 2: Using the VIGS system to carry out functional research on EbMYB5 and EbMYB52 genes in red onions

[0069] 1. Primer design and vector construction for EbMYB5 and EbMYB52

[0070] The vector construction method is the same as in Example 1. EbMYB5 (the gene nucleotide sequence is shown in SEQ ID NO.3) and EbMYB52 (the gene nucleotide sequence is shown in SEQ ID NO.4), in the VIGS experiment, the vector construction of pTRV2-EbMYB5 uses primers: Primer sequence 5'-3'F: TACCGAATTCTCTAGAGTGTGGCACACCCACTTAAAG; R: CTTCGGGACATGCCCGGGTCAGATATCAGGCAATTCCAGAG, the length of the target fragment is 300bp. The vector construction of pTRV2-EbMYB52 uses primers: primer sequence 5'-3'F: TACCGAATTCTCTAGACGACCCGTGTCCGTCGCCTCCCC; R: CTTCGGGACATGCCCGGGTCATGATCTATAGTATCTAATCAC, the target fragment length is 351bp. The enzyme cutting sites selected in the pTRV2 vector are Xba I: TCTAGA, upstream; Smal I: CCCGGG, downstream. After silencing by VIGS technology, TRV2-EbMYB5 or TRV2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method and application of a VIGS (Vinyl Insulin Growth Sulfate) silencing system of an iridaceae plant eleutherine eleutherine. The VIGS silence system suitable for the eleutherine eleutherine is successfully created by taking the TRV as a carrier of a VIGS system and taking an eleutherine eleutherine phytoene dehydrogenase gene as a target gene and utilizing a vacuum infiltration treatment method; the system is applied to development of gene function research of Euphorbia elegans pigment synthesis related genes EbMYB5 and EbMYB52, the expression quantity of the EbMYB5 and EbMYB52 genes in infected silence treatment group sample leaves is remarkably reduced, and the expression quantity of key genes related to pigment synthesis routes is remarkably changed to different degrees; the eleutherine americana VIGS silencing system can be successfully applied to eleutherine americana gene function verification. The eleutherine americana VIGS silence system constructed by the invention has important significance on eleutherine americana gene function research.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a method for constructing a VIGS silencing system of the Iridaceae plant shallot and its application. Background technique [0002] Eleutherine bulbosa (Mill.) Urb., a plant of the Iridaceae family, is native to the West Indies, the Americas, etc., and was later introduced and cultivated by folks in Yunnan, and developed into a traditional folk medicinal plant in Southwest China such as Yunnan and Guangxi. Red onion has multiple functions such as antibacterial and anti-inflammatory (Padhi and Panda, 2015), and can also be eaten as wild vegetables (Pan Jun et al., 2011; Wang Xiaoyi et al., 2015; Xu Qiaolin et al., 2014). Iridaceae red onion is similar to the well-known vegetable Allium ascalonicum L. (Allium ascalonicum L.) in its bulb appearance and name, so it is easy to be confused. In the 1980s, studies on the chemical constituents and pharmacolo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/84C12N15/53C12N15/61C12N15/54A01H5/00A01H6/00
CPCC12N15/825C12N15/8218C12N9/001C12N9/90C12N9/1037C12N9/1048C12N9/0073C12Y103/99029C12Y505/01006C12Y203/01074C12Y114/13021
Inventor 王丛丛林国森何春梅王洪峰苏凌业徐明锋
Owner GUANGDONG ACAD OF FORESTRY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products