Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of PsPIWI-RE protein derived from pseudomonas stutzeri in mediated homologous recombination

A technology of Pseudomonas stutzeri and homologous recombination, which is applied in the fields of application, recombinant DNA technology, and other methods of inserting foreign genetic materials, and can solve problems such as off-target effects and PIWI-RE protein functions that have not been reported yet

Active Publication Date: 2022-03-11
SHANGHAI JIAO TONG UNIV
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Although CRISPR / Cas9 technology is relatively mature, there are still some technical defects that need to be improved
The main disadvantages of CRISPR / Cas9 technology include: Off-target effects, that is, the editing of non-target genes
As a PIWI family protein without a complete Ago domain, the function of PIWI-RE protein has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of PsPIWI-RE protein derived from pseudomonas stutzeri in mediated homologous recombination
  • Application of PsPIWI-RE protein derived from pseudomonas stutzeri in mediated homologous recombination
  • Application of PsPIWI-RE protein derived from pseudomonas stutzeri in mediated homologous recombination

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Construction of PsPIWI-RE mutants

[0043] In order to illustrate the mechanism of PsPIWI-RE protein in vivo, the PIWI-RE protein deletion mutant strain of Pseudomonas stutzeri (Pseudomonasstutzeri DSM4166) was constructed.

[0044] Firstly, the upstream 1000 bp and downstream 1000 bp DNA fragments of the coding gene of PIWI-RE protein (PsPIWI-RE, Accession number: WP_014597637.1) of Pseudomonas stutzeri (Pseudomonas stutzeri DSM4166) were cloned.

[0045] Wherein, the amino acid sequence of PIWI-RE protein is shown in SEQ ID NO.1.

[0046] Among them, the upstream homology arm amplification primer:

[0047] dPSago-F1 ACGGTTGTTCATAGGGTTCTCTG

[0048] dpsAgo-R1 TCATCTCGCGTCCTTTCTTGATTC;

[0049] Downstream homology arm amplification primers:

[0050] dPsAgo-F2GGAATGAATCACCCCGGGTTTC

[0051] dPsAgo-R2 TAGCGGATCGAGACGTACTGG

[0052] The genomic DNA of Pseudomonas stutzeri DSM4166 was extracted as the amplification template. The above primers were used to amplify 100...

Embodiment 2

[0067] Effect of PIWI-RE deletion mutation on growth status of P. stutzeri strains, determination of growth curves

[0068] Pseudomonas stutzeri DSM4166 was designated as P. stutzeri strain.

[0069] The successfully knocked-out strain obtained in Example 1 is designated as P. stutzeriΔpiei-re.

[0070] To illustrate the effect of PIWI-RE deletion mutation on the growth state of P. stutzeri, the growth curves of P. stutzeri and P. stutzeri△piei-re strains were measured. Streak activation was performed on P. stutzeri and P. stutzeri△piwi-re strains, and the plaques were picked and inoculated into 5 mL LB medium, cultivated overnight at 30°C, and transferred to 100 mL LB medium according to 1 / 100. 30°C, 220RPM shaker culture, measure OD every 1h 600 , draw growth curves, and analyze whether there are significant differences in the growth states of P. stutzeri and P. stutzeri△piwi-re.

[0071] image 3 For the comparison of the growth curves of P. stutzeri and P. stutzeri△piw...

Embodiment 3

[0073] PIWI-RE involved in DNA damage repair and homologous recombination assays

[0074] It has been reported that TtAgo is involved in DNA replication, helping the separation of circularly packed DNA after replication. NgAgo participates in DNA homologous recombination and improves the efficiency of homologous recombination. Explore PIWI-RE's involvement in DNA replication or DNA homologous recombination pathways, reveal the mechanism of PIWI-RE protein in vivo, and provide a theoretical basis for the construction of a gene editing system based on PIWI-RE protein.

[0075] In order to determine whether PIWI-RE protein is involved in DNA replication or DNA homologous recombination pathway, the detection of P. stutzeri and P. Mycin C, MMC) tolerance differences. Streak activation of P. stutzeri and P. stutzeri△piwi-re strains, inoculate into 5mL LB medium, culture overnight at 30°C, measure OD 600 , the OD 600 The same two bacterial solutions were divided into three groups...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an application of PsPIWI-RE (Pseudomonas stutzeri-derived PsPIWI-RE protein) in mediating homologous recombination. The research finds that the PsPIWI-RE protein derived from the pseudomonas stutzeri affects DNA (deoxyribonucleic acid) replication and a DNA damage repair way; the invention discloses construction and application of a PsPIWI-RE protein mediated escherichia coli gene knockout technology derived from Pseudomonas stutzeri. The method comprises the following steps: firstly, constructing PsPIWI-RE protein expression plasmids from pseudomonas stutzeri and recombinant plasmids with left and right homologous arm sequences of gene sequences to be knocked out; and then transforming escherichia coli by using two plasmids, inducing double-exchange recombination, and obtaining a strain of which a target gene is knocked out through phenotypic screening or PCR (Polymerase Chain Reaction) identification. According to the operating system, the gene editing system based on the PsPIWI-RE protein and the homologous sequence is constructed for the first time. And a new excellent tool is provided for gene editing of microorganisms such as escherichia coli.

Description

technical field [0001] The invention relates to the technical field of prokaryotic gene editing, in particular to the application of PsPIWI-RE protein derived from Pseudomonas stutzeri in mediating homologous recombination. Background technique [0002] Gene editing technology is a technology that inserts, deletes, and replaces the genomic DNA sequence of cells. This technology can realize the heritable modification of genomic DNA, so that the target cells can produce knock-out or knock-in of specific genes. This technology is of great significance to genetic engineering, agricultural development, biomedical research, gene therapy and other fields. At present, more mature gene editing technologies include: ZFN technology, TALEN technology, CRISPR technology, etc. Among them, CRISPR technology, as an emerging gene editing technology, has attracted widespread attention due to its advantages of simple operation, low cost, and low off-target rate. In 2020, two scientists, Emma...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/21C12N15/31C12N15/78C12N15/66C12N15/90C12N1/21C12R1/38
CPCC07K14/21C12N15/78C12N15/66C12N15/902Y02A50/30
Inventor 冯雁黄飞
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com